CORONA Main Coronavirus thread

[Heliobas Disciple]

Within-host selection pressure does NOT dictate viral evolution and thus does not correlate with the emergence of SARS-CoV-2 variants in highly Covid-19 vaccinated populations.

Contrary to the implications of this publication (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10063955/), studying within-host diversity of SARS-CoV-2 (SC-2) may not always be a scientifically robust approach for investigating viral evolution, especially in the context of

voiceforscienceandsolidarity.substack.com

(fair use applies)


Within-host selection pressure does NOT dictate viral evolution and thus does not correlate with the emergence of SARS-CoV-2 variants in highly Covid-19 vaccinated populations.
Geert Vanden Bossche
Apr 25, 2024

Contrary to the implications of this publication (Within-host genetic diversity of SARS-CoV-2 lineages in unvaccinated and vaccinated individuals), studying within-host diversity of SARS-CoV-2 (SC-2) may not always be a scientifically robust approach for investigating viral evolution, especially in the context of mass vaccination against a virus causing acute self-limiting infection (ASLI) or during subsequent vaccine breakthrough infections (VBTIs), such as those caused by Omicron.

In highly Covid-19 (C-19) vaccinated populations, the evolutionary trajectory and dynamics of ASLI-causing viruses are primarily shaped by the immune selection pressure exerted by the entire vaccinated population on viral infectiousness or transmissibility, rather than by individual vaccinated hosts. In other words, the within-host mutation rate does not reflect the impact of mass vaccination or widespread VBTIs. Cross-neutralizing antibodies generated in response to VBTIs caused by Omicron target more conserved antigenic domains within the spike protein and thereby constrain the mutation rate within a single C-19 vaccinated host while driving large-scale immune evasion at the population level within highly C-19 vaccinated populations.

The population-level immune selection pressure on the virus persists as long as herd immunity is not achieved.

In conclusion, since the emergence of Omicron, within-population selection pressure has driven the widespread emergence and co-circulation of a diversified spectrum of immune escape variants within highly C-19 vaccinated populations.

 

[Heliobas Disciple]

How things could change... ("Het kan verkeren")

(please find translation into Dutch below)

voiceforscienceandsolidarity.substack.com

(fair use applies)


How things could change...
Geert Vanden Bossche
Apr 24, 2024

The above graph was kindly posted on X (formerly known as 'Twitter') yesterday by Yunlong Richard Cao.

As shown in this graph, the descendants of BA2.86/JN.1 do indeed have a transmission advantage over JN.1. However, they are increasingly finding it difficult to gain ground on JN.1, as evidenced by the decreasing exponential growth of recently emerged variants. Due to the persistent dominance of JN.1, virus transmission occurs too slowly, or in other words, the immune pressure from highly C-19 vaccinated populations on virus transmission remains too high. The only possibility I see for the virus to break through this pressure is a sudden and drastic change in the glycosylation profile of the spike protein. This change will be of such a nature that it enables the virus to overcome the inhibition of virus virulence by non-neutralizing antibodies. In this way, the virus will be able to spread and replicate fully, not only from one individual to another, but especially within the same vaccinated person.

 

[Heliobas Disciple]

https://www.thailandmedical.news/news/german-study-finds-that-antibiotic-use-in-hospitalized-covid-19-patients-offers-no-beneficial-clinical-outcomes

(fair use applies)


German Study Finds That Antibiotic Use In Hospitalized COVID-19 Patients Offers No Beneficial Clinical Outcomes
Nikhil Prasad Fact checked by:Thailand Medical News Team
Apr 26, 2024

The COVID-19 pandemic has brought forth numerous challenges, among which is the appropriate use of antibiotics in hospitalized patients. Recent research from Germany sheds light on this issue, revealing that antibiotic treatment in adults with moderate COVID-19 may not yield beneficial clinical outcomes and could potentially lead to deterioration. This COVID-19 News report delves into the implications of this study, emphasizing the need for judicious antibiotic use and improved stewardship interventions in the context of viral pandemics like COVID-19.


The Study's Background and Objectives
The study findings, to be presented at the coming ESCMID Global Congress in Barcelona, Spain (ESCMID Global) focused on analyzing data from the German National Pandemic Cohort Network (NAPKON) comprising 1,317 hospitalized adults with confirmed SARS-CoV-2 infection between March 2020 and May 2023. The primary objective was to investigate the impact of antibiotic use on the clinical progression of COVID-19 patients, particularly those with moderate disease severity.


Rationale Behind Antibiotic Use in COVID-19 Patients
Dr Anette Friedrichs, the lead author of the study, highlighted the rationale for antibiotic use in COVID-19 patients. Antibiotics are typically prescribed when bacterial co- or superinfections are suspected or confirmed, especially in cases where a second infection develops on top of COVID-19. However, distinguishing between bacterial superinfections and advanced stages of COVID-19 can be challenging, leading to the overuse of antibiotics in hospitalized patients diagnosed with COVID-19.


Data Analysis and Patient Characteristics
The study cohort consisted of predominantly middle-aged individuals, with a significant proportion being male. Patients were categorized based on disease severity using the WHO Clinical Progression Scale, with a focus on those classified as having moderate disease (WHO score 4-5). Of these patients, 41% received antibiotic treatment during their hospital stay, primarily targeting respiratory infections. Notably, older age, male gender, greater disease severity, higher comorbidity burden, and lack of prior COVID-19 vaccination were associated with increased likelihood of antibiotic treatment.


Impact of Antibiotic Therapy on Clinical Progression
The researchers assessed patients' clinical status after 14 days using the WHO Clinical Progression Scale, accounting for various COVID-19 risk factors. The analysis revealed that patients treated with antibiotics had a five-fold greater risk of clinical deterioration compared to those not receiving antibiotics. Additionally, patients aged 65 or older faced a three-fold increased likelihood of COVID-19 deterioration, indicating a potential interaction between age, antibiotic use, and disease progression.


Details of Findings
Utilizing the WHO Clinical Progression Scale, the study team identified 1,149 patients who were classified as having moderate disease (WHO score 4-5), of whom 467 (41%) were treated with antibiotics commonly used for respiratory infections such as ß-Lactam-antibiotics, macrolides, or moxifloxacin during their hospital stay. Some were also given azithromycin or neomycin.

Another 168 patients were classed as having severe disease (WHO score 6-9), of whom 118 (70%) also received antibiotic treatment. The data on these patients are still being analyzed.

Detailed microbiological investigations of patients with moderate disease found only 11 patients with a superinfection with a bacterium that can also cause pneumonia - eight patients treated with antibiotics and three who did not receive antibiotics. The study team noted that the low number of patients with documented respiratory bacterial superinfection might be due to missing microbiological diagnostics or missing documentation of results. Other bacterial infections suggestive for antibiotic therapy were not included in the analysis.

The study team then analyzed the influence of antibiotic therapy on patients' clinical status after 14 days measured using the WHO Clinical Progression Scale, which reflects a patient's trajectory and resource use over the course of clinical illness. The score indicates disease severity incorporating hospital admission, oxygen requirement, ventilator support, admission to intensive care unit and organ replacement therapy. The score was calculated for each patient at the initial clinician's consultation, and again 14 days later to see whether the score had improved, remained stable, or worsened.

Upon controlling for COVID-19 risk factors including age, sex, and underlying medical conditions, the analyses found that clinical improvement in patients with moderate disease was significantly better for younger, female, and vaccinated patients.

Significantly, patients given antibiotics had five times greater risk of clinical deterioration after 14 days compared to those not treated with antibiotics. Similarly, being aged 65 or older trebled the likelihood of COVID-19 deterioration compared to those aged 18-50 years.

Dr Friedrichs commented, "This increased risk is possibly due to unknown additional factors that result in worse outcomes and are associated with antibiotic treatment. One potential factor that was only occasionally documented is a bacterial superinfection, as well as other bacterial infections. Importantly, however, clinical deterioration can also develop from the side effects of unnecessarily prescribed antibiotics."

Thailand Medical News would like to add that while research in animal studies showed that certain antibiotics had favourable results, it should be noted that in infected COVID-19 individuals, the virus is able to cause damages to the heart and kidneys and certain antibiotics are known to cause QT prolongation and arrhythmias and also cause kidney damage, thus aggravating conditions in those already infected with SARS-CoV-2.


Understanding the Risk Factors and Implications
Dr Friedrichs emphasized that while bacterial superinfections or other bacterial infections could contribute to clinical deterioration, the adverse effects of unnecessary antibiotics cannot be overlooked. The study's findings underscore the need for cautious antibiotic prescribing practices, especially during viral pandemics. Furthermore, the lack of documented bacterial infections in a significant proportion of patients receiving antibiotics raises concerns about indiscriminate antibiotic use.


Lessons Learned and Recommendations
The COVID-19 pandemic serves as a critical lesson for future viral outbreaks, highlighting the importance of rational antibiotic use and strengthened stewardship programs. Dr Friedrichs advocates for limiting antibiotics to patients with suspected bacterial coinfections and conducting appropriate microbiological diagnostics before initiating treatment. Moreover, discontinuing antibiotics when bacterial coinfections are unlikely is essential to mitigate the risk of antibiotic resistance and adverse outcomes.


Study Limitations and Generalizability
Despite its insights, the study has limitations inherent to its observational nature and single-country focus. The findings may not fully capture all contributory factors influencing clinical outcomes in COVID-19 patients globally. Therefore, caution is warranted when extrapolating these results to diverse populations and healthcare settings.


Conclusion: Navigating Antibiotic Use in COVID-19 Care
In conclusion, the German study's findings shed light on the complexities surrounding antibiotic use in hospitalized COVID-19 patients. While antibiotics play a crucial role in managing bacterial infections, their indiscriminate use can exacerbate antimicrobial resistance and lead to adverse clinical outcomes. Moving forward, a balanced approach that integrates evidence-based antibiotic prescribing, stringent diagnostic criteria, and robust stewardship initiatives is imperative to optimize patient care during viral pandemics.

 

[Heliobas Disciple]

Early tests of H5N1 prevalence in milk suggest U.S. bird flu outbreak in cows is widespread

The prevalence of H5N1 genetic material in purchased milk products suggests the bird flu outbreak is far more widespread in cows than official counts indicate.

www.statnews.com

(fair use applies)


Early tests of H5N1 prevalence in milk suggest U.S. bird flu outbreak in cows is widespread
By Megan Molteni
April 25, 2024

Andrew Bowman, a veterinary epidemiologist at Ohio State University, had a hunch. He had been struck by the huge amounts of H5N1 virus he’d seen in milk from cows infected with the bird flu and thought that at least some virus was getting off of farms and going downstream — onto store shelves.

He knew the Food and Drug Administration was working on its own national survey of the milk supply. But he was impatient. So he and a graduate student went on a road trip: They collected 150 commercial milk products from around the Midwest, representing dairy processing plants in 10 different states, including some where herds have tested positive for H5N1. Genetic testing found viral RNA in 58 samples, he told STAT.

The researchers expect additional lab studies currently underway to show that those samples don’t contain live virus with the capability to cause human infections, meaning that the risk of pasteurized milk to consumer health is still very low. But the prevalence of viral genetic material in the products they sampled suggest that the H5N1 outbreak is likely far more widespread in dairy cows than official counts indicate. So far, the U.S. Department of Agriculture has reported 33 herds in eight states have tested positive for H5N1.

“The fact that you can go into a supermarket and 30% to 40% of those samples test positive, that suggests there’s more of the virus around than is currently being recognized,” said Richard Webby, an influenza virologist who has been analyzing the samples at St. Jude’s Children’s Research Hospital in Memphis, Tenn., where he heads the WHO Collaborating Center for Studies on the Ecology of Influenza in Animals.

Earlier this week, the FDA announced that its effort had found evidence of the H5N1 virus in samples of milk purchased from store shelves, but it provided no detailed results. On Thursday, during an online symposium hosted by the Association of State and Territorial Health Officials, the FDA disclosed a high-level readout from the agency’s investigation. Results returned Thursday morning showed PCR-positive milk in 20% of samples, “maybe with some preponderance for areas with known herds,” said Donald Prater, acting director of the FDA’s Center for Food Safety and Applied Nutrition. He did not say how many samples the FDA had analyzed or from what geographic area.

The testing by PCR — polymerase chain reaction — turned up only genetic traces of the virus, not evidence that it’s alive or infectious. The FDA has been adamant that H5N1, which is heat-sensitive, is very likely killed through the process of pasteurization.

The agency is still assessing those samples for viral viability by attempting to grow virus from milk found to contain RNA from H5N1. The FDA plans to release results of those studies in the coming days. On Wednesday, Jeanne Marrazzo, the new director of the National Institute of Allergy and Infectious Diseases, told reporters that a team of NIAID-funded researchers had early data to suggest that pasteurization does appear to be effective.

The team that produced that data — the St. Jude and OSU groups — told STAT that it has so far analyzed four samples of store-bought milk that had tested positive via PCR for H5N1 genetic material. “We’ve done the viral growth assays to see if we can recover any virus from them and we can’t,” Webby said.

Those four samples came from an initial collection of 22 commercial milk products purchased in the Columbus, Ohio, area. “It was basically just me hitting up the five grocery stores between campus and my house,” said Bowman.

PCR testing at OSU revealed three of those 22 products to be positive for viral RNA. Bowman sent them to Webby to inject into plates of mammalian cells and embryonated chicken eggs and look for any signs of active viral replication. In order to do that, Webby needed a negative control, so he went and bought milk at a store near his lab in Memphis. But PCR testing found H5N1 RNA in that sample too, making it useless as a negative control, but an additional data point showing a lack of live virus.

That sample is still in Webby’s fridge at home. He used it to make dinner earlier this week. “I’m not concerned about it all,” he said.

Although the risk of infection from dairy products is very low, the worry is that the wider H5N1 spreads in cows, the more opportunities the virus has to adapt to transmit efficiently in mammalian hosts. It also increase the chances H5N1 could get into pigs, where it could swap genes and form hybrids with other flu viruses. Viruses that mutate to be able to spread easily through one species of mammals could find it easier to infect people.

The St. Jude group is now repeating its analyses with the additional samples Bowman and his graduate student bought around the Midwest. Their early findings provide further evidence that H5N1 is spreading broadly among dairy cows in the U.S.

This week, researchers examining viral genome sequences released Sunday by the USDA found that the outbreak has likely been underway for months longer than previously known. “Both of these data — the milk data and the genetic data that shows this has been around since December of last year — suggests that the outbreak is probably much bigger than we know,” said Angie Rasmussen, a virologist who studies emerging zoonotic pathogens at the Vaccine and Infectious Disease Organization at the University of Saskatchewan in Canada.

It may also signal that herds can be infectious with only mild symptoms or no symptoms at all, which would complicate the response and make containment much more difficult.

“This is telling us that we’re probably already seeing that milk from asymptomatically infected cows does have some virus in there,” said Andrew Pekosz, a molecular microbiologist who studies respiratory viruses at Johns Hopkins Bloomberg School of Public Health.

So far, there has been only one report of H5N1 infections in a cattle herd with no symptoms — in North Carolina. But USDA officials have not disclosed further details beyond the fact that milk from infected but asymptomatic cows seems unchanged.

In H5N1-infected cows, the first thing that tends to happen is their appetite disappears and their activity goes down. Then their milk production dries up. In some animals, the milk they do produce turns yellow and thick. “It’s an odd thing that seems to be unique to this particular virus,” said Keith Poulsen, director of the Wisconsin Veterinary Diagnostic Laboratory. And it’s one of the chief red flags that dairy farmers are supposed to be on the lookout for when deciding whether to test their herds. If milk from asymptomatic or pre-symptomatic cows looks normal but can carry virus, it would obscure the need for testing.

To really understand the scale of spread as well as possible mechanisms of viral transmission, it’s necessary to conduct widespread testing of animals with and without symptoms, said Jennifer Nuzzo, an epidemiologist and director of Brown University’s Pandemic Center. “If we’re only testing cows with outward symptoms, we’re missing infections in those without.”

Up until this week, USDA policy did not require testing of any animals, and only recommended it for dairy cows greater than 3 years of age that have been lactating for at least 150 days and are showing severe clinical symptoms like fever, lethargy, abnormal milk production, and loose stool.

On Wednesday, the agency issued a federal order requiring an animal to test negative for the virus before it can be transported across state lines. It also requires laboratories and state veterinarians to report to the USDA any animals that have tested positive for H5N1 or any other influenza A virus. But outside of interstate travel, testing remains voluntary and encouraged only for visibly ill animals.

Public health experts told STAT that such narrow testing criteria are likely distorting the true extent of the outbreak. “I have not seen evidence that makes me want to discard the fear that testing practices are absolutely shaping what we think we know about this virus,” Nuzzo said. “We just don’t have the right data right now to tell us what’s going on.”

The situation is reminiscent, she said, of the Covid-19 pandemic. In the early weeks of that outbreak, testing policies were narrow — limited to symptomatic individuals who had traveled to China. Meanwhile, the SARS-CoV-2 virus was spreading undetected throughout the U.S., as genomic analyses would later show. Later, when at-home tests became widely available, official counts became unreliable, leaving state and local health departments in the dark.

“At least with Covid, wastewater surveillance eventually kicked in to supplement our picture,” Nuzzo said. “With H5N1, we don’t have that.”

On Wednesday, the Centers for Disease Control and Prevention said it is exploring wastewater testing for H5N1, but noted significant hurdles, including farms not being linked to municipal wastewater systems and the potential for infected wild birds to confound testing of water around farms.

Requiring dairy farms to regularly test all their animals, including asymptomatic ones, is not logistically feasible given the current capacity of state veterinary diagnostic laboratories, Poulsen said. He and other lab directors are already bracing for the massive ramp-up in testing they expect to begin when the USDA order goes into effect Monday. But he does think more has to be done at the federal level to encourage farmers to test their herds.

“At this point, farms just aren’t volunteering samples because they don’t have any incentives to raise their hand,” Poulsen said. That information blackout makes it much more challenging for epidemiologists to trace the virus and understand how it’s spreading, the exact mechanisms of which are still unclear.

“We need to do what we can now to understand it and contain it so it doesn’t turn into a pathogen of pandemic potential,” Poulsen said. “That is a real risk if we continue to ignore it.”

 

[Heliobas Disciple]

I've studied bird flu for 20 years. This is why I'm not drinking milk

Dr Rick Bright, a virologist and former director at the Department of Health and Human Services, revealed the decision online - saying he had concerns the virus could still be active in milk.

www.dailymail.co.uk

(fair use applies)


I've studied bird flu for 20 years and here's why I stopped drinking milk..as FDA begin testing dairy cows for deadly virus
By Luke Andrews Senior Health Reporter For Dailymail.Com
Published: 15:21 EDT, 25 April 2024 | Updated: 15:56 EDT, 25 April 2024

• Dr Rick Bright, a former HHS director, says he will no longer drink milk from cows
• He is concerned about bird flu being detected in samples from grocery stores

A top bird flu scientist has declared he is no longer drinking cow's milk amid the alarming outbreak in cattle across American farms.

Dr Rick Bright, a virologist and former director at the Department of Health and Human Services, revealed his decision on X, warning that the virus — which has infected two Americans so far — could still be active in milk.

'Minor inconvenience to pause my milk consumption while waiting for data,' he said. 'Delayed transparency influenced my decision.

'Having worked with this virus for nearly three decades, I've learnt to respect it and its surprises.'

The worrying comments come days after the FDA revealed traces of the virus have been detected in grocery store milk, with separate testing in Ohio suggesting nearly 40 percent of all milks in stores could be affected.

Scientists are demanding more evidence from officials to prove that milk is safe after pasteurization, when it is rapidly heated and then cooled to 'kill off' any viruses or bacteria.

Experts are particularly weary of assurances from public health bosses — as the FDA previously said the virus could not enter the milk supply due to pasteurization.

Dr Bright said: 'I've spent 27 years studying H5N1 viruses. So, I'm going to wait for data I hope is coming soon from both FDA (pasteurization) and USDA (genomic data and raw milk handling).'

He added: 'When H5N1 [the strain of bird flu] news broke, [I said] "They would have to do a lot of testing before I would drink milk from one of these farms at this point".

Some experts have suggested that the traces detected in milk represented dead virus, which means heating the liquid had effectively killed off the microbes.

A total of 33 farms have reported cases of bird flu in cattle to date

Jeanne Marrazzo, the new director of the National Institute of Allergy and Infectious Diseases, revealed yesterday that scientists had found H5N1 found in milk samples bought from stores did not grow in petri dishes.

The work was, however, done on only a small number of samples — she admitted — and the study has not been released to the public.

'While this is welcome news, the effort studied a small number of samples that is not necessarily representative of all retail milk,' she said, reports STAT.

'So to really understand the scope here, we need to wait for the FDA effort.'

There are also concerns over the potential for bird flu to enter the meat supply, but so far the virus has only been detected in dairy cattle.

Readers of Dr Bright's post have also expressed conern over drinking milk — including Karen Piper, from Seattle, who said: 'I think I will pause on the milk until they figure this out.'

A second said, 'if you're not drinking milk, I'm not drinking milk,' and a third added, 'I told my husband last week, no milk. I'm not sounding alarms yet but I am watching closely.'

The concern among scientists is that people could be infected by virus lurking in milk they drink.

But there is no evidence that this has happened at present, with the one case in a dairy farm worker in Texas linked to direct exposure to the cattle.

Officials fear the outbreak in cattle is, 'much more widespread' than previously thought, however.

A total of 33 dairy farms across eight states have so far detected the virus, although officials fear it is also in other farms.

Some sick cows produce milk that is a different color, but others that have tested positive have no symptoms — with their milk likely still entering the human supply.

In the Ohio tests, 58 out of the 150 commercial milks swabbed were found to contain RNA from the virus.

Dr Richard Webby, an influenza virologist at St Jude's Children's Hospital in Memphis, Tennessee, said: 'The fact that you can go into a supermarket and 30 to 40 percent of those samples test positive, that suggest there's more of the virus around than is currently being recognized.'

Dr Bright was the director of the Biomedical Advanced Research and Development Authority (BARDA) from 2016 to 2020, but was then moved to a role at the National Institutes of Health.

At the time, he had suggested that hydroxychloroquine was not an effective Covid treatment — contradicting the President.

He filed a whistleblower complaint saying the administration had ignored his Covid warnings and illegally retaliated against him by ousting him from his role.

The complaint was settled in 2021 with back pay and compensation for 'emotional stress and reputational damage'.

He is now the president of the Pandemic Prevention and Response center at the Rockefeller Foundation, and based in Washington DC.

 

[Heliobas Disciple]

RINTRAH is a vegan and pushes vegan in a lot of the things he posts. I'm posting this anyway because there's important info in here; I just read past the vegan promotion part. ymmv

Who wants some milk? – Rintrah

(fair use applies)


Who wants some milk?
April 25, 2024
Nelly the Clever Pig

I have some good news. If you live in freedomland, there’s a 62% chance the pack of milk you bought at your supermarket doesn’t have any bird flu in it!

​

“This comes after a lab at Ohio State University detected genetic material of the virus in 38% of retail milk samples they’ve tested, data that also suggests the current outbreak is being underreported.” USDA Now Requiring Mandatory Testing and Reporting of HPAI in Dairy Cattle as New Data Suggests Virus Outbreak is More Widespread pic.twitter.com/TdJTR0KZu6​

​

— Diego Bassani, PhD (@DGBassani) April 24, 2024​

​

“No we’re not doing this again.”

Yes, we’re totally doing this again! Get ready for your next incarnation! The extradimensional jesters are getting bored, they’re rolling this reality up as we speak!

Pasteurization kills the virus. Probably. Nobody really knows if it’s good enough. If it kills 99.99% of viral particles, is that good enough, on a population of hundreds of millions of people? You tell me. If I drop a thousand grenades into a fireworks factory, but reduce the number of grenades I throw by 99%, is the outcome any different?

You can also drink raw milk of course, like every alpha male does. Klaus Schwab probably just came up with another hoax to stop patriotic alpha males on the keto diet from raising their testosterone with raw milk.

Four percent of Americans report drinking raw milk in a given year. And this virus has been spreading in the cattle since late 2023. It just took a few months before we noticed it.

But cats don’t seem to like the raw milk from these sick cows. It causes their brains to swell up:

​

“And then someone called me and said half of his cats had passed away without warning, and so then all the alarm bells start going off in your head.” pic.twitter.com/hl8Q9FQf4E​

— Diego Bassani, PhD (@DGBassani)​

​

Bird to cow to cow to cat. You get a mammalian adapted polybasic cleavage site influenza virus, with rising virulence, very good at swelling your brain. Fortunately, if you’re drinking raw milk because some guy on Twitter told you to and you have a normal sized skull, your brain should have plenty of empty space in your skull to swell up in.

“This is like with COVID where they miss 99% of the mild and asymptomatic cases.” -Team Nothingburger

Wouldn’t count on it bro.

In South America, the sea lions had 95% of their babies die.

Sorry. There’s a reason I always carry a bag of ketamine in my wallet.

It’s not normal influenza. It’s influenza that evolved to have a polybasic cleavage site in the giant chicken boilers. This does not happen in nature. It’s believed to be because the intermediate stage, of variants with a cleavage site with a smaller number of basic amino acids, have no fitness advantage in nature. The polybasic cleavage site allows it to infect endothelial cells. So it goes for the blood vessels in the brain.

And it gets better. That guy in Texas who caught it doesn’t seem to have had direct contact with the cattle:

​

H5N1: Human case 'can’t be easily linked' to cattle cases​

Tom Peacock: "The individual was either infected in a separate event – maybe not via a cow, but through contact with infected wild birds"​

STATGenetic analysis reveals H5N1 flu virus outbreak in cows likely started earlier than thought​

— CoronaHeadsUp (@CoronaHeadsUp) April 24, 2024​

​

They don’t know how he caught it. But have a look at the Influenza A in sewage in the Texas panhandle:

​

Via @maolesen & @Mistsandgrass. Context: Amarillo, TX, is in the cattle belt there. #H5N1 is a subtype of Influenza A; i.e., a sharp rise in flu A (subtypes unknown) is a warning signal. pic.twitter.com/6ncokD0IZv​

— Tim Skellett (@Gurdur) April 23, 2024​

A strange unseasonal spike.

And that’s seen around the whole south of the US now.

They now announced restrictions on the transport of cattle between states, that will begin in a few days.

On H5N1 bird flu:​

"USDA has identified spread between cows within the same herd, spread from cows to poultry, spread between dairies associated with cattle movements, and cows without clinical signs that have tested positive."​

In 1 case, H5N1 was found in a lung tissue sample.​

— BNO News (@BNOFeed) April 24, 2024​

It has already been established however, that the virus jumps from cows back into birds. Birds don’t respect state lines. And you’re already too late, as it’s already everywhere. It’s in a third of all your milk sold in the supermarket.

So this is just too little too late.

Please keep in mind, these pathogenic influenza viruses generally need a few generations of transmission within a species, to regain a high level of virulence. That’s the nasty part. Bird flu can spread from human to human, but because the virus will still be mild, we won’t notice it. It could look just like COVID19 at first.

In the best case scenario, your food just gets unaffordable:

Michigan: 6.5 million chickens killed this month after H5N1 outbreaks​

USDA pays farms for birds and eggs that are destroyed because of the flu.​

"As of January, more than $1 billion had reportedly been spent on these payments."Michigan Local News, Breaking News, Sports & Weather Why 6.5 million chickens were killed in Michigan this month​

— CoronaHeadsUp (@CoronaHeadsUp) April 24, 2024​

​

No eggs, no chicken, no dairy, no beef.

But it seems doubtful that this is where it stops. The birds are now beginning to spread the mammal-adapted bird flu that spreads from the cattle back to the birds.

There is at least some general understanding that humans will have to stop burning fossil fuels. But none of these people have really been honest to us about animal agriculture. Had they been honest, they would have told us that this is the problem:

You just can’t have a situation like this for very long.

But that’s not what anyone wants to hear from his president, or from some scientist on TV. Imagine this conversation, between a smart person and your average American liberal:

“We’ll have to stop using fossil fuels.”

“Alright, so I’ll get to drive a Tesla, right?”

“Well, we’re actually going to need you to ride a bicycle or take the bus.”

“Wait what?”

“We won’t have electricity all day long, so you wouldn’t be able to charge your cars. The grid can’t handle it, unless you live in Norway perhaps.”

“Oh…”

“Yeah while I’m at it, we’ll need you to stop eating meat, dairy and eggs too.”

“…” *puts on a red MAGA hat*

Genetically identical chickens put together in giant airtight facilities, that’s how you breed nasty viruses. All our animals are basically standing in the stench of their own manure, all day long. This causes damage to their lungs,
73.1% of pigs are found to have lung lesions, from viruses and bacteria. Pigs are clean animals, they don’t shit where they live. This only happens when you put them all together in cages.

Drinking raw milk from other mammals, that’s how we spread viruses into our own species.

If you want to fit eight billion people on this little blue marble, they’re going to have to be vegan. And if those eight billion people don’t want to be vegan, nature will get to pick who has to go. I suppose you can add some mussels and oysters to the diet of those eight billion people. But the point is that this planet has an overabundance of a small number of vertebrate species, with billions of practically genetically identical individuals. Nature is currently in the process of resolving that distortion.

So why America?

Well, the Americans have the genius habit of feeding bird poop, mixed with feathers, chicken feed, bird saliva and other crap found in their chicken boilers, to their cows. Yes, they just take the junk found in the chicken boiler on the floor, scrape it up and turn it into cattle feed. But it gets better. The chicken feed can contain ground up cow meat and bones. So the cows are basically made to eat each other.

That seems like the best candidate for what went wrong, although nobody knows for sure.

But there’s a fair chance other countries just are not testing. Bird flu is everywhere in the Netherlands. Dead foxes were already being found with brain damage from mammal-adapted bird flu in the Netherlands back in 2022. We even have live camera video, of a Dutch falcon dying of suspected bird flu from this year:

A bird cam in the Netherlands captured a falcon dying of suspected bird flu and falling out of the nest. Her chicks died a short time later.​

(Warning: Upsetting images) pic.twitter.com/gQO6pfDgku​

— BNO News (@BNOFeed) April 24, 2024​

​

I have basically been sperging about this topic since the day I grew pubes. But it doesn’t take a genius to figure this stuff out.

It’s just very obvious that this Auschwitz planet of eight billion people eating 202 million chickens per day is not going to work. I’m honestly amazed we were ever able to get to this point. If I was running this planetary petri dish, I would have thrown a bunch of comets at it decades ago.

I know what the morons are going to be doing:

“We need better hygiene practices at Auschwitz! We can’t have Jews spreading their Jew-typhus from Auschwitz to the cities! Improve the disinfection procedures for the concentration camp guards!”

“The American keto diet is non-negotiable.”

-George Herbert Walker Bush

Well sorry, it’s not going to work.

Every moron out there sees some video of some animal being gored or living in a giant dark cage and comes up with some story along the lines of:

“Industrial scale animal farming is really terrible! Thank God I get my grassfed beef from farmer Bob down at the farmer market, who kisses every cow on her cheek before he slits her throat!”

Well I’m sorry, you can either have industrial scale farming like this, or you can massively amplify the environmental damage by having a romantic fantasy of a nation of farmer Bobs with their grassfed cows wandering around.

Everything moves towards efficiency. These giant Auschwitz camps are the efficient way to produce animal products, with very little waste of resources. The more it begins to resemble your romantic fantasy, the more incapable it becomes of feeding hundreds of millions of Americans.

“My eggs come from free range chickens!”

Great, that means they get a better chance to spread the bird flu to wild birds!

It’s very simple, you can wean eight billion people off animal products, or you can have a bunch of brain-swelling influenza viruses jump into our species.

We don’t live in the middle ages anymore, we can’t entertain fancy theories like those of rabbis who theorized that slaughtering animals is ethical because it liberates the soul and allows them to become human again. The message we get from nature now is pretty clear and unambiguous, we’re going to destroy our whole planet and spread a bunch of deadly viruses, if we keep eating animals.

We’re really, really late into the game. Heaven knows if it can still be stopped.

Cows are wonderful​

It’s so sad how we’ve been conditioned to see certain animals as undeserving of moral consideration, simply because we’ve bred them to such large numbers that we fail to see them as the unique individuals that they are. pic.twitter.com/tDbeNFFvbU​

— Sherry w/ a whY (@S_Catsgotmyback) April 24, 2024​

~~~~~~~~~~~~~~~~~~~~

ADDING SOME COMMENTS FROM THE ABOVE ARTICLE. Radagast is for some reason now posting under the name Nelly the Clever Pig.


Michael
April 25, 2024 at 1:32 pm

Meh. Dont test. No disease.

In all seriousness I dont expect this to blow up. It is the new normal where “experts” only see problems, when more work at “monitoring”, culling, testing and control than finding out real solutions. Like this: We should take that viral thing as a baseline how dense we can herd animals. No vaccines, no hormones. Maybe Vitamin D or other nutritional hacks.


Nelly the Clever Pig
April 25, 2024 at 1:44 pm

>Maybe Vitamin D or other nutritional hacks.

Hahahahahahahahahahaha

Jesus Christ

You think the sea lions in South America that had 95% of their pups die were vitamin D deficient?

“If we feed the sea lions megadoses of vitamin D, we’ll get the mortality rate down to just 5%, with the other 95% having some mild brain damage!”

You think if there was some nutritional hack that saves the chickens from bird flu, the Chinese would not have tried that yet?

They have been struggling with bird flu killing off all their chickens for decades now, they tried vaccinating the birds, it did not work.

You think you’re going to supplement your way out of a virus that is destroying entire ecosystems right now?

Bird flu sends Scots seabirds into 'catastrophic' decline, landmark study finds

In Scotland one bird species was reduced by 76%. In a single year.

You are just in complete denial.

You’ve reached the point where ecosystems around the world are starting to collapse from abnormally pathogenic bird flu.

And yet, you’re still not seeing it.

Sad!

 

[Heliobas Disciple]

Combating the Next Pandemic: Experts Call for Global Genetic Warning System

Scientists champion global genomic surveillance using the latest technologies and a ‘One Health’ approach to protect against novel pathogens like avian influenza and antimicrobial resistance, catching epidemics before they start. The COVID-19 pandemic turned the world upside down. In fighting it, o

scitechdaily.com

(fair use applies)


Combating the Next Pandemic: Experts Call for Global Genetic Warning System
By Frontiers
April 25, 2024

Scientists champion global genomic surveillance using the latest technologies and a ‘One Health’ approach to protect against novel pathogens like avian influenza and antimicrobial resistance, catching epidemics before they start.

The COVID-19 pandemic turned the world upside down. In fighting it, one of our most important weapons was genomic surveillance, based on whole genome sequencing, which collects all the genetic data of a given microorganism. This powerful technology tracked the spread and evolution of the virus, helping to guide public health responses and the development of vaccines and treatments.

But genomic surveillance could do much more to reduce the toll of disease and death worldwide than just protect us from COVID-19. Writing in the journal Frontiers in Science, an international collective of clinical and public health microbiologists from the European Society for Clinical Microbiology and Infectious Diseases (ESCMID) calls for investment in technology, capacity, expertise, and collaboration to put genomic surveillance of pathogens at the forefront of future pandemic preparedness.

“Epidemic-prone infectious diseases cross borders as fast as people and trade goods travel around the world,” said lead author Prof Marc Struelens of the Université libre de Bruxelles, Belgium, and formerly Chief Microbiologist at the European Centre for Disease Prevention and Control (ECDC). “A local outbreak today may become the world’s next pandemic crisis tomorrow.”


A Vital Head Start

Most illnesses not seen before in humans are zoonoses—diseases found in animals that infect humans. Many diseases in animals are also treated with antibiotics and other antimicrobials that are used for humans. However, the widespread use of antimicrobials in humans and animals has led to resistance, as microbes evolve to survive. So we face two major, overlapping public health threats: one from new infectious diseases that are zoonoses, and one from rising antimicrobial resistance. Tackling these threats requires a collaborative One Health approach—championed by the World Health Organization (WHO)—which recognizes that human health is dependent on the health of our ecosystem.

The answer, the scientists say, is to repurpose the increased genomic surveillance technology and capacity brought by COVID-19 to act as sentinels. Genomic surveillance that brings together public health agencies, veterinarians, and doctors need to be used to monitor human and animal diseases and antimicrobial resistance. By integrating epidemiological and clinical data from all these fields, we can get a comprehensive picture of pathogens and the risks they pose.

“Pathogen genomic surveillance is a tool that looks at the interplay between antimicrobial selective pressure on populations of microbes and the adaptive evolution of those microbes towards drug resistance,” said Struelens. “It lets us detect the emergence and disentangle the transmission dynamics of super-fit, multidrug-resistant epidemic clones—’superbugs’. Genomic surveillance can help track both zoonotic and inter-human transmission of viral variants, strains of bacteria, and signs of drug resistance.”


Rapid Detection and Response

Real-time genomic surveillance of pathogens can allow us to quickly detect new strains of resistant bacteria and new diseases making the jump between humans and animals, and to monitor their spread and evolution.

This information can inform vaccination campaigns, help design targeted treatments, and guide public health responses—all of which could help prevent epidemics from flaring up.

Monitoring whole genomes would also allow us to study new diseases and the evolution of known diseases in more depth, to gauge how dangerous they are and identify countermeasures. In a globalized world, where pathogens travel quickly, genomic surveillance would make it possible to diagnose and treat infections equally quickly.

Struelens and his colleagues highlight how new sequencing technologies, including long-read genomic sequencing, ultra-rapid sequencing, and single-cell sequencing, and artificial intelligence are helping to drive progress in surveillance in some parts of the world.

“There are many places where genomic surveillance is already providing crucial protection against the spread of disease,” said Struelens. “This includes foodborne infections in Europe, North America, and Australia, and epidemic viral diseases like avian influenza across many countries worldwide.”


Building Global Surveillance Networks

To make genomic surveillance effective, the scientists say, we need worldwide, accessible, real-time data. To achieve this, we need massive investment in capacity and expertise that takes into account different levels of infrastructure and training available around the world. During the COVID-19 pandemic, countries that already had access to genomic surveillance expertise and equipment had a major advantage in monitoring the pandemic and tailoring their response. The authors provide a framework for the equitable implementation of globally interconnected surveillance systems that include lower- and middle-income countries.

“The article by Struelens et al. is a must-read for anyone interested in genomic surveillance as part of epidemic preparedness,” said Prof Marion Koopmans from the Erasmus Medical Center in Rotterdam, Netherlands, in an accompanying editorial. “The tools and ambition are there—the next step is to build equitable, collaborative surveillance infrastructures for future global health. The proposed WHO ‘Pandemic Treaty’ will be key, defining some of the rules of international engagement for better preparedness. Interesting times ahead!”

We also urgently need to invest in collaboration, to build bridges between disciplines in animal health, human, and public health, and to liaise between countries and health agencies. This will be critical to ensure not just that stakeholders can work together but that we reach agreements over data management and regulation, so that patients’ data is anonymized and safeguarded.

“To ensure universal participation in collaborative systems of genomic surveillance around the world, our critical challenges are sufficient laboratory and sequencing capacity, the training of an expert workforce, and access to validated genomic data analysis and sharing tools within a comprehensive, secure digital health information infrastructure,” said Struelens. “Integrating epidemic pathogen genomic information with epidemiological information must happen at scale, from the local to global level.”

Reference: “Real-time genomic surveillance for enhanced control of infectious diseases and antimicrobial resistance” 25 April 2024, Frontiers in Science.
DOI: 10.3389/fsci.2024.1298248

 

[Heliobas Disciple]

FDA Study: Covid Shots Caused Heart Failure Surge in Children - Slay News

Covid mRNA shots are responsible for surges in heart failure and seizures among children, a new study commissioned by the U.S. Food and Drug Administration has revealed.

slaynews.com

(fair use applies)


FDA Study: Covid Shots Caused Heart Failure Surge in Children
Frank Bergman
April 26, 2024 - 12:55 pm

Covid mRNA shots are responsible for surges in heart failure and seizures among children, a new study commissioned by the U.S. Food and Drug Administration has revealed.

The study was conducted as part of an FDA public health surveillance mandate and published Wednesday in the renowned peer-reviewed medical journal JAMA.

According to the study, large numbers of children have suffered serious health issues after being injected with the Covid mRNA shots.

The researchers found that heart failure, in the form of myocarditis or pericarditis, was found in vaccinated children under 5 years old.

“Statistical signals were detected for myocarditis or pericarditis after BNT162b2 vaccination in children aged 12 to 17 years and seizure after vaccination with BNT162b2 and mRNA-1273 in children aged 2 to 4 or 5 years,” the study said.

Myocarditis is inflammation of the heart muscle, and pericarditis is inflammation of the outer lining of the heart.

Both myocarditis and pericarditis restrict the heart’s ability to pump blood around the body and can cause blood clots, strokes, cardiac arrest, and sudden death.

According to the U.S. Centers for Disease Control and Prevention (CDC), both myocarditis and pericarditis are known side effects of Covid mRNA injections.

The study investigated data from Covid-injected adolescents aged 12-17 and discovered a “safety signal” after administration of the Pfizer mRNA jab.

That “safety signal” was for myocarditis or pericarditis.

It was the same signal that had already been previously identified in prior studies.

However, a new “safety signal” was identified in the new FDA study.

The new “safety signal” was for seizures in children.

The signal for seizures was found in data of Covid-vaccinated children between 2-4 years old who got the Pfizer mRNA injection (BNT162b2).

It was also discovered among those between 2-5 years old who received the Moderna mRNA shot (mRNA-1273).

Heart inflammation can be fatal, according to this study, this study, and this website.

Another study, published in March, found that kids between 2-5 who received a Covid mRNA vaccine were 2.5 times as likely to have a febrile seizer within a day of being injected than they were to have one between 8-63 days after injection.

Also, a government-funded report recently found a link between Covid mRNA injections and myocarditis.

Not surprisingly, the JAMA study downplayed the risks associated with the mRNA vaccine.

In the “Discussion” section, the study said:

“The new statistical signal for seizure observed in our study should be interpreted with caution and further investigated in a more robust epidemiologic study.”

Despite the growing body of evidence regarding the risks associated with the injections, the CDC still recommends that most adults and children continue taking the shots.

This latest study comes as Slay News reported on the explosive allegations from a medical industry whistleblower about the vaccines.

A hospital whistleblower has come forward to warn the public that Covid mRNA shots are causing people to “die so horrifically” and “so quickly” after they received the injections.

The whistleblower, known only as “Zoe,” revealed that doctors have been euthanizing patients due to the severity of the side effects from the injections.

Zoe, a hospital medical coder, said the health issues caused by the Covid shots were so “horrific” that the Covid-vaccinated patients “kind had to be put down” by doctors.

In a whistleblowing interview with the nonprofit Children’s Health Defense (CHD), Zoe revealed that hospitals and medical professionals were simply not prepared for the wave of sudden deaths, heart attacks, organ failure, and now cancers among the vaccinated population that followed since the Covid shots were rolled out to the public in early 2021.

“I didn’t know it was possible for a human to die so horrifically, so quickly, before they rolled out the mRNA injections,” Zoe revealed.

“It was insane, I’ve never seen anything like that.

“The worst of them, they called it sepsis, but it was like instant multi-organ failure.

“Like, within hours patients would die of liver, lung, kidney… failure [all at once]…”

“Some of the records…[from the] emergency crew that found them [the injection victims], it’s like their body tried to reject everything,” she added.

“[In] some of these cases, their family would be there 30 minutes before, and then within an hour they’re dead.”

“[For] days, patients would be seizing, and no medications would stop it, and eventually they…kinda had to be put down,” she revealed.

 

[psychgirl]

FDA Study: Covid Shots Caused Heart Failure Surge in Children - Slay News

Covid mRNA shots are responsible for surges in heart failure and seizures among children, a new study commissioned by the U.S. Food and Drug Administration has revealed.

slaynews.com

(fair use applies)


FDA Study: Covid Shots Caused Heart Failure Surge in Children
Frank Bergman
April 26, 2024 - 12:55 pm

Covid mRNA shots are responsible for surges in heart failure and seizures among children, a new study commissioned by the U.S. Food and Drug Administration has revealed.

The study was conducted as part of an FDA public health surveillance mandate and published Wednesday in the renowned peer-reviewed medical journal JAMA.

According to the study, large numbers of children have suffered serious health issues after being injected with the Covid mRNA shots.

The researchers found that heart failure, in the form of myocarditis or pericarditis, was found in vaccinated children under 5 years old.

“Statistical signals were detected for myocarditis or pericarditis after BNT162b2 vaccination in children aged 12 to 17 years and seizure after vaccination with BNT162b2 and mRNA-1273 in children aged 2 to 4 or 5 years,” the study said.

Myocarditis is inflammation of the heart muscle, and pericarditis is inflammation of the outer lining of the heart.

Both myocarditis and pericarditis restrict the heart’s ability to pump blood around the body and can cause blood clots, strokes, cardiac arrest, and sudden death.

According to the U.S. Centers for Disease Control and Prevention (CDC), both myocarditis and pericarditis are known side effects of Covid mRNA injections.

The study investigated data from Covid-injected adolescents aged 12-17 and discovered a “safety signal” after administration of the Pfizer mRNA jab.

That “safety signal” was for myocarditis or pericarditis.

It was the same signal that had already been previously identified in prior studies.

However, a new “safety signal” was identified in the new FDA study.

The new “safety signal” was for seizures in children.

The signal for seizures was found in data of Covid-vaccinated children between 2-4 years old who got the Pfizer mRNA injection (BNT162b2).

It was also discovered among those between 2-5 years old who received the Moderna mRNA shot (mRNA-1273).

Heart inflammation can be fatal, according to this study, this study, and this website.

Another study, published in March, found that kids between 2-5 who received a Covid mRNA vaccine were 2.5 times as likely to have a febrile seizer within a day of being injected than they were to have one between 8-63 days after injection.

Also, a government-funded report recently found a link between Covid mRNA injections and myocarditis.

Not surprisingly, the JAMA study downplayed the risks associated with the mRNA vaccine.

In the “Discussion” section, the study said:

“The new statistical signal for seizure observed in our study should be interpreted with caution and further investigated in a more robust epidemiologic study.”

Despite the growing body of evidence regarding the risks associated with the injections, the CDC still recommends that most adults and children continue taking the shots.

This latest study comes as Slay News reported on the explosive allegations from a medical industry whistleblower about the vaccines.

A hospital whistleblower has come forward to warn the public that Covid mRNA shots are causing people to “die so horrifically” and “so quickly” after they received the injections.

The whistleblower, known only as “Zoe,” revealed that doctors have been euthanizing patients due to the severity of the side effects from the injections.

Zoe, a hospital medical coder, said the health issues caused by the Covid shots were so “horrific” that the Covid-vaccinated patients “kind had to be put down” by doctors.

In a whistleblowing interview with the nonprofit Children’s Health Defense (CHD), Zoe revealed that hospitals and medical professionals were simply not prepared for the wave of sudden deaths, heart attacks, organ failure, and now cancers among the vaccinated population that followed since the Covid shots were rolled out to the public in early 2021.

“I didn’t know it was possible for a human to die so horrifically, so quickly, before they rolled out the mRNA injections,” Zoe revealed.

“It was insane, I’ve never seen anything like that.

“The worst of them, they called it sepsis, but it was like instant multi-organ failure.

“Like, within hours patients would die of liver, lung, kidney… failure [all at once]…”

“Some of the records…[from the] emergency crew that found them [the injection victims], it’s like their body tried to reject everything,” she added.

“[In] some of these cases, their family would be there 30 minutes before, and then within an hour they’re dead.”

“[For] days, patients would be seizing, and no medications would stop it, and eventually they…kinda had to be put down,” she revealed.

Some of this is so bad it almost …almost…reads as some serious WOO.
If we didn’t already know a lot of this it WOULD be WOO.

 

[Zoner]

Combating the Next Pandemic: Experts Call for Global Genetic Warning System

Scientists champion global genomic surveillance using the latest technologies and a ‘One Health’ approach to protect against novel pathogens like avian influenza and antimicrobial resistance, catching epidemics before they start. The COVID-19 pandemic turned the world upside down. In fighting it, o

scitechdaily.com

(fair use applies)


Combating the Next Pandemic: Experts Call for Global Genetic Warning System
By Frontiers
April 25, 2024

Scientists champion global genomic surveillance using the latest technologies and a ‘One Health’ approach to protect against novel pathogens like avian influenza and antimicrobial resistance, catching epidemics before they start.

The COVID-19 pandemic turned the world upside down. In fighting it, one of our most important weapons was genomic surveillance, based on whole genome sequencing, which collects all the genetic data of a given microorganism. This powerful technology tracked the spread and evolution of the virus, helping to guide public health responses and the development of vaccines and treatments.

But genomic surveillance could do much more to reduce the toll of disease and death worldwide than just protect us from COVID-19. Writing in the journal Frontiers in Science, an international collective of clinical and public health microbiologists from the European Society for Clinical Microbiology and Infectious Diseases (ESCMID) calls for investment in technology, capacity, expertise, and collaboration to put genomic surveillance of pathogens at the forefront of future pandemic preparedness.

“Epidemic-prone infectious diseases cross borders as fast as people and trade goods travel around the world,” said lead author Prof Marc Struelens of the Université libre de Bruxelles, Belgium, and formerly Chief Microbiologist at the European Centre for Disease Prevention and Control (ECDC). “A local outbreak today may become the world’s next pandemic crisis tomorrow.”


A Vital Head Start

Most illnesses not seen before in humans are zoonoses—diseases found in animals that infect humans. Many diseases in animals are also treated with antibiotics and other antimicrobials that are used for humans. However, the widespread use of antimicrobials in humans and animals has led to resistance, as microbes evolve to survive. So we face two major, overlapping public health threats: one from new infectious diseases that are zoonoses, and one from rising antimicrobial resistance. Tackling these threats requires a collaborative One Health approach—championed by the World Health Organization (WHO)—which recognizes that human health is dependent on the health of our ecosystem.

The answer, the scientists say, is to repurpose the increased genomic surveillance technology and capacity brought by COVID-19 to act as sentinels. Genomic surveillance that brings together public health agencies, veterinarians, and doctors need to be used to monitor human and animal diseases and antimicrobial resistance. By integrating epidemiological and clinical data from all these fields, we can get a comprehensive picture of pathogens and the risks they pose.

“Pathogen genomic surveillance is a tool that looks at the interplay between antimicrobial selective pressure on populations of microbes and the adaptive evolution of those microbes towards drug resistance,” said Struelens. “It lets us detect the emergence and disentangle the transmission dynamics of super-fit, multidrug-resistant epidemic clones—’superbugs’. Genomic surveillance can help track both zoonotic and inter-human transmission of viral variants, strains of bacteria, and signs of drug resistance.”


Rapid Detection and Response

Real-time genomic surveillance of pathogens can allow us to quickly detect new strains of resistant bacteria and new diseases making the jump between humans and animals, and to monitor their spread and evolution.

This information can inform vaccination campaigns, help design targeted treatments, and guide public health responses—all of which could help prevent epidemics from flaring up.

Monitoring whole genomes would also allow us to study new diseases and the evolution of known diseases in more depth, to gauge how dangerous they are and identify countermeasures. In a globalized world, where pathogens travel quickly, genomic surveillance would make it possible to diagnose and treat infections equally quickly.

Struelens and his colleagues highlight how new sequencing technologies, including long-read genomic sequencing, ultra-rapid sequencing, and single-cell sequencing, and artificial intelligence are helping to drive progress in surveillance in some parts of the world.

“There are many places where genomic surveillance is already providing crucial protection against the spread of disease,” said Struelens. “This includes foodborne infections in Europe, North America, and Australia, and epidemic viral diseases like avian influenza across many countries worldwide.”


Building Global Surveillance Networks

To make genomic surveillance effective, the scientists say, we need worldwide, accessible, real-time data. To achieve this, we need massive investment in capacity and expertise that takes into account different levels of infrastructure and training available around the world. During the COVID-19 pandemic, countries that already had access to genomic surveillance expertise and equipment had a major advantage in monitoring the pandemic and tailoring their response. The authors provide a framework for the equitable implementation of globally interconnected surveillance systems that include lower- and middle-income countries.

“The article by Struelens et al. is a must-read for anyone interested in genomic surveillance as part of epidemic preparedness,” said Prof Marion Koopmans from the Erasmus Medical Center in Rotterdam, Netherlands, in an accompanying editorial. “The tools and ambition are there—the next step is to build equitable, collaborative surveillance infrastructures for future global health. The proposed WHO ‘Pandemic Treaty’ will be key, defining some of the rules of international engagement for better preparedness. Interesting times ahead!”

We also urgently need to invest in collaboration, to build bridges between disciplines in animal health, human, and public health, and to liaise between countries and health agencies. This will be critical to ensure not just that stakeholders can work together but that we reach agreements over data management and regulation, so that patients’ data is anonymized and safeguarded.

“To ensure universal participation in collaborative systems of genomic surveillance around the world, our critical challenges are sufficient laboratory and sequencing capacity, the training of an expert workforce, and access to validated genomic data analysis and sharing tools within a comprehensive, secure digital health information infrastructure,” said Struelens. “Integrating epidemic pathogen genomic information with epidemiological information must happen at scale, from the local to global level.”

Reference: “Real-time genomic surveillance for enhanced control of infectious diseases and antimicrobial resistance” 25 April 2024, Frontiers in Science.
DOI: 10.3389/fsci.2024.1298248

Yeah, just what we need... increased surveillance.

 

[jward]

Jim Ferguson
@JimFergusonUK
Alert: An Admission of Epic Proportions’: Health Canada Confirms DNA Plasmid Contamination of COVID Vaccines

Health Canada has confirmed the presence of DNA contamination in Pfizer COVID-19 vaccines and also confirmed that Pfizer did not disclose the contamination to the public health authority.

The DNA contamination includes the Simian Virus 40 (SV40) promoter and enhancer Pfizer did not previously disclose and that some experts say is a cancer risk due to potential integration with the human genome.

Health Canada, the country’s public health authority, told The Epoch Times that while Pfizer provided the full DNA sequences of the plasmid in its vaccine at the time of the initial submission, the vaccine maker “did not specifically identify the SV40 sequence.”

“Health Canada expects sponsors to identify any biologically functional DNA sequences within a plasmid (such as an SV40 enhancer) at the time of submission,” it said.

Health Canada’s admission came after two scientists, Kevin McKernan and Phillip J. Buckhaults, Ph.D., discovered the presence of bacterial plasmid DNA in the mRNA COVID-19 vaccines at levels potentially 18-70 times higher than the limits set by the U.S. Food and Drug Administration (FDA) and the European Medicines Agency.

They tested four expired Pfizer and Moderna vaccine vials “thought to only contain mRNA” and found to contain “double-stranded DNA plasmids.”

Health Canada said, “We have concluded that the risk/benefit profile continues to support the use of the Pfizer-BioNTech vaccine,” and that it does rely on manufacturer claims but “conducts an in-depth independent review” to make sure the vaccines meet “our high standards for safety, efficacy and quality.”

Janci Lindsay, Ph.D., director of toxicology and molecular biology for Toxicology Support Services, told The Defender this statement is “silly, not believable and not defendable,” adding that “We should not have to do the research that they should have done.”

“Why are the FDA, CDC [Centers for Disease Control and Prevention] and the mainstream media still silent about this?” asked Steve Kirsch, founder of the Vaccine Safety Research Foundation, adding that “the mainstream medical community is silent as well.”

Viral immunologist Dr. Byram Bridle of the University of Guelph in Canada, commenting on Health Canada’s admission wrote on his Substack, “This is an admission of epic proportions.”
#Canada #Pfizer

Canada Reports 300% Increase in ‘Unspecified Causes’ of Death, Sparking Calls for Investigation

A new Canadian government report reveals a 300% rise in “unspecified causes” of death from 2019-2022 as unknown causes climbed to the fifth leading cause of death in Canada. Some health experts said the stark increase should trigger an investigation into whether the deaths are linked to COVID-19...

childrenshealthdefense.org

 

[Heliobas Disciple]

Long COVID Condition Resolves Over Time, Study Suggests

Australian research finds that long COVID symptoms improved over time in their study cohort.

www.theepochtimes.com

(fair use applies)


Long COVID Condition Resolves Over Time, Study Suggests
Australian research finds that long COVID symptoms improved over time in their study cohort.
By Lily Kelly
4/27/2024

Research led by the University of New South Wales (UNSW) and St Vincent’s Hospital in Sydney has found that the immune abnormalities in most people with mild or moderate long COVID had largely resolved two years after infection.

In a cohort of patients suffering from long COVID, biomarkers present in patients eight months after contraction largely resolved by 24 months, suggesting that long COVID can settle over time.
Biomarkers are biological molecules that can indicate diseases or health conditions, the U.S. National Cancer Institute states.

Long COVID clinical symptoms are consistent with biomarkers exhibiting a sustained inflammatory response.


Details of the Study

The study participants included people who had contracted COVID-19 in Australia’s first wave and a corresponding control group. The study considered the health information systematically reported by patients and detailed blood tests.

The exact scale of immunological improvement is difficult to quantify because immune function significantly varies from person to person. However, after 24 months there were no observable differences between the study’s control and long COVID group.

Chansavath Phetsouphanh, co-author of the paper and senior lecturer at UNSW’s Kirby Institute, said in a news release that significant improvements have been found.

“Almost one and a half years later, we are pleased to see that among this same group, significant improvements were found in blood markers,” he said.
Blood markers are an easily accessible, cost-effective, and accurate biomarker.

“For the majority of samples we analysed in the laboratory, the biomarkers previously indicating abnormal immune function have resolved,” Mr. Phetsouphanh said.

This trend was also observable in the self-reported data with 62 percent of participants indicating improvements in health-related quality of life.


Study Limitations

The study is one of a small number that measures clinical data, self-reported health information, and intense blood sampling of the same group over an extensive period.

Professor Anthony Kelleher, director of the Kirby Institute, said that immunology is a complex science.

While the finding was encouraging, he noted it involved just one cohort that experienced an early strain of COVID-19 and whose initial COVID-19 infection was generally considered mild or moderate.

Prof. Kelleher said they cannot say for certain that outcomes in the unvaccinated clinical cohort will be true for vaccinated people. He also said that it’s uncertain whether those infected with a different strain of COVID-19 will experience the same outcomes.

“What we do know is that for most people with long COVID, both their symptoms and their biomarkers improve significantly over time, and this is a cause for optimism,” he said.

“Importantly, we will continue to undertake research to understand more about why some people don’t improve, and what can be done for those people.”


Ongoing Impact on their Life Quality

“While this is very encouraging and a reason for optimism, there are still around one third of patients who identify some ongoing impact on their quality of life,” said Professor Gail Matthews, head of infectious diseases at St Vincent’s Hospital.

Prof. Matthews said some patients may have a range of underlying causes for their long COVID symptoms.

She added that not all of these causes are driven by immunological abnormalities and that some are likely to persist even when the immunological environment has largely returned to normal.

 

[Heliobas Disciple]

https://www.thailandmedical.news/news/study-identifies-virological-characteristics-of-the-sars-cov-2-kp-2-variant-one-of-the-variants-behind-spring-s-silent-covid-19-surge

(fair use applies)


Study Identifies Virological Characteristics Of The SARS-CoV-2 KP.2 Variant, One Of The Variants Behind Spring’s Silent COVID-19 Surge
Nikhil Prasad Fact checked by:Thailand Medical News Team
Apr 27, 2024

Many are unaware that there is currently a silent rise in COVID-19 infections occurring in parts of United Kingdom, Netherlands, Germany, France, United States, India, China, Japan, Australia, Russia, Iran and New Zealand.

Government authorities are simply downplaying or concealing the statistical COVID-19 data and mainstream media have been bought to refrain from writing too much about these rising infections. Even by reducing testing and changing to waste-waste monitoring companies that are more compliant to government policies, many independent sources are still clearly indicating a rise of infections.

Unfortunately, even search engines are now shadow-banning or lowering the news feed exposure of any COVID-19 News coverages that report about rising COVID-19 cases in any geolocations.

What is worrying however is that the rise of the new COVID-19 waves are being driven by a totally new line of SARS-CoV-2 JN.1 spawns including the KP variant with its lineages like KP.1, KP.1.1, KP.1.1.1, KP.2, KP.2.2 KP.3, KQ.1, KS.1 and KR.1.

Most of these new variants are also known at the FLiRT variants and spot the mutations F456L and R346T which give them an effective growth advantage over other circulating variants and are more immune evasive and transmissible.

The KP variants in particular are behind the new COVID-19 surges that are underway and are expected to play a key role in this Spring’s surges.

The ongoing evolution of the SARS-CoV-2 virus has led to the emergence of various variants, each with unique characteristics influencing its transmissibility, virulence, and immune evasion. Among these variants, the KP.2 variant, a descendant of the JN.1 lineage, has garnered attention for its rapid spread and potential impact on public health.

A new study by researchers from the University of Tokyo-Japan, Kobe University-Japan, Keio University School of Medicine-Japan, Tokyo Medical and Dental University-Japan, Tokyo Metropolitan Institute of Public Health-Japan, Kumamoto University-Japan and MRC-University of Glasgow Centre for Virus Research-UK delves into the virological features of the SARS-CoV-2 KP.2 variant, shedding light on its genetic makeup, fitness advantages, and immune evasion strategies.


Evolutionary Trajectory of the JN.1 Variant
The JN.1 variant, originating from the BA.2.86(.1) lineage with the S:L455S substitution, demonstrated increased fitness and successfully outcompeted the previously dominant XBB lineage by early 2024. This evolutionary success led to the diversification of the JN.1 lineage, giving rise to progenies with key spike protein substitutions such as S:R346T and S:F456L. Notably, one of these progenies, the KP.2 variant (JN.1.11.1.2), emerged as a rapidly spreading variant in multiple regions by April 2024.


Genetic Composit ion of the KP.2 Variant
The KP.2 variant carries three notable substitutions in the Spike (S) protein, including S:R346T and S:F456L, along with an additional substitution in non-S protein regions compared to its precursor JN.1. These genetic alterations are crucial in understanding the variant's biological behavior and potential impact on transmission dynamics.


Enhanced Fitness and Epidemiological Impact
Through Bayesian multinomial logistic modeling based on genome surveillance data from the USA, United Kingdom, and Canada, the relative effective reproduction number (Re) of KP.2 was estimated. The analysis revealed that KP.2 exhibits 1.22-, 1.32-, and 1.26-fold higher Re values compared to JN.1 in the respective countries. These findings indicate a higher viral fitness for KP.2, suggesting its potential to become the predominant lineage globally.


Spread and Frequency Dynamics
By the beginning of April 2024, the estimated variant frequency of KP.2 had already reached 20% in the United Kingdom, indicating its rapid dissemination within a short timeframe. This escalating frequency underscores the variant's ability to outcompete existing lineages and establish itself as a significant contributor to the ongoing pandemic dynamics.


Infectivity and Immune Resistance
In terms of infectivity, KP.2 demonstrated a significant 10.5-fold decrease in infectivity compared to JN.1, as observed in pseudovirus assays. Furthermore, neutralization assays using sera from monovalent XBB.1.5 vaccinees and individuals with breakthrough infections highlighted KP.2's heightened resistance to neutralization. The 50% neutralization titer (NT50) against KP.2 was notably lower than that against JN.1 across all tested scenarios, indicating a reduced susceptibility to vaccine-induced and infection-acquired immunity.


Implications for Public Health and Vaccination Strategies
The findings regarding KP.2's increased immune resistance and higher Re values have critical implications for public health interventions and vaccination strategies. The variant's ability to evade neutralizing antibodies to a greater extent than previous variants, including JN.1, necessitates ongoing surveillance, rapid variant characterization, and potential adjustments to vaccine formulations or booster strategies to maintain efficacy against evolving strains.


Conclusion
In conclusion, the SARS-CoV-2 KP.2 variant exhibits distinct virological characteristics, including enhanced fitness, rapid spread, reduced infectivity, and increased immune resistance. Understanding these features is paramount in effectively managing and responding to the ongoing COVID-19 pandemic. Continued genomic surveillance, coupled with proactive public health measures and adaptive vaccination campaigns, remains essential in mitigating the impact of emerging variants like KP.2 and ensuring optimal control of viral transmission.

The study findings were published on a preprint server and are currently being peer reviewed.

Virological characteristics of the SARS-CoV-2 KP.2 variant

The JN.1 variant (BA.2.86.1.1), arising from BA.2.86(.1) with the S:L455S substitution, exhibited increased fitness and outcompeted the previous dominant XBB lineage by the biggening of 2024. JN.1 subsequently diversified, leading to the emergence of descendants with spike (S) protein...

www.biorxiv.org

Thailand Medical News would like to add that why we think that these KP variants are more worrisome is because not only are they more immune evasive but they are believed to be better at disarming all the initial host immune responses and are suited for viral persistence. However, as they are also good at disarming the specific immune response in various reservoir segments across the body, they can silently cause enough cell, tissue and critical cellular pathway damage in these areas before actual symptoms manifest signifying a serious problem. We can expect to see a higher incidence of various organ failures and sepsis from these variants along with other serious medical issues.

 

[Heliobas Disciple]

https://www.thailandmedical.news/news/breaking-h5n1-strains-emerging-in-cows-possess-new-mutation-na-t438i-associated-with-reduced-susceptibility-to-neuraminidase-inhibitors

(fair use applies)


H5N1 Strains Emerging In Cows Possess New Mutation NA-T438I Associated With Reduced Susceptibility To Neuraminidase Inhibitors
Nikhil Prasad Fact checked by:Thailand Medical News Team
Apr 28, 2024

While the U.S. CDC is still insisting that many of the antivirals it has in its stockpile such as Oseltamivir (Tamiflu) and Baloxavir marboxil, sold under the brand name Xofluza are effective against the current H5N1 strains in circulation, there are many incidences elsewhere globally where situations have shown that these drugs no longer work against the all the new H5N1 strains that have been in circulation in the last 18 months.

For instance, in the reported deaths in various past H5N1 News coverages of individuals infected with H5N1 in Cambodia, Vietnam and Chile, it was found that the administration of both Tamiflu and Xofluza did not prevent the resulting deaths in these individuals even when treatment with the said antivirals started in the initial stages.

We can still see mistakes that were made in the COVID-19 pandemic still being made in the preparations for the impending H5N1 outbreak. Instead of spending monies, resources and time into developing a combo of effective and safe antivirals to combat H5N1, governments are once again funding mRNA vaccine developments with the same players in the pharma industry and in some cases also spending monies on monoclonal therapeutics research.

Instead of moving away from antibody-based prophylactics or therapeutics that are known to induce the virus to mutate even further, many are still doing the same mistake of simply focusing on vaccines and monoclonal drugs.


U.S. CDC Finds Mutation In H5N1 Virus That Shows the Virus Is Evolving And Developing Resistance To Neuraminidase Inhibitors
In a recent updated report by the U.S. CDC, it was reported that researchers had indeed found a mutation on one virus sequence from cows that showed reduced susceptibility to present neuraminidase inhibitors.

Avian Influenza A(H5N1) U.S. Situation Update and CDC Activities

CDC continues to respond to the public health challenge posed by a multistate outbreak of avian influenza A(H5N1) virus, or “A(H5N1) virus” in dairy cows and other animals in the U.S.

www.cdc.gov

The new H5N1 mutation NA-T438I worryingly indicates that the virus is indeed evolving towards a direction of drug resistance towards known neuraminidase inhibitors.


Research On New Drugs Are Bring Up The Worse Drug Candidates
There are some ongoing researches by certain scientist who are being over-zealous and adamant that their identified candidates are suitable to prevent or treat H5N1 infections despite not looking at the total macro perspective as to how three quarters of the global population have been already exposed to either the SARS-CoV-2 virus or the COVID-19 mRNA vaccines and how these are affecting their immunity systems and other organs.

Hence, without wanting to go into details, some of these compounds like neomycin, galactans are simply going to backfire.


A Multiprong Drug Candidate Needed
Thailand Medical News strongly recommends that H5N1 prophylactic and therapeutics being developed should encompass a variety of compounds that act as neuraminidase and hemagglutin Inhibitors plus M2 ion channel inhibitors. Also including targeting the ribonucleoprotein would help create a real efficient broadspecturm antiviral. Simply targeting one component of the H5N1 virus is not going to help.

Avian Influenza A viruses are known to evolve and mutate rapidly, though not at the rate of the current SARS-CoV-2 viruses, they do so more efficiently against known antiviral compounds.

We also urge readers and journalists to do more investigations into the reported case of a farm hand had who got infected in Texas and was claimed to have been treated and also recovered.

 

[Heliobas Disciple]

China is gunning for the chief scientist of its COVID vaccine project, accusing him of 'serious discipline and law violations'

Yang Xiaoming was kicked from the National People's Congress earlier this month. He was in charge of the team that created the Sinopharm vaccine.

news.yahoo.com

(fair use applies)


China is gunning for the chief scientist of its COVID vaccine project, accusing him of 'serious discipline and law violations'
Matthew Loh - Business Insider
Mon, April 29, 2024, 2:10 AM EDT

• The chief scientist of China's COVID vaccine project was kicked from the National People's Congress.
• Yang Xiaoming, 62, is accused of "serious discipline and law violations," a phrase alluding to corruption.
• Yang led the team that developed the Sinopharm vaccine, and was China's top researcher in its vaccine project.

The chief researcher of China's first general-use COVID vaccine was ousted last week from the country's highest organ of power.

Yang Xiaoming, 62, was booted on April 23 from the National People's Congress "due to serious discipline and law violations," state media reported this weekend.

The phrase typically means a person is under investigation for corruption in China.

That means Yang, the chairman of Sinopharm's vaccine subsidiary China National Biotec Group, is no longer one of the nearly 3,000 congressional deputies who make decisions on major national issues.

A congressional report on his dismissal said he served on the Ethnic Affairs Committee.

Yang is a medical researcher who led the Sinopharm team that developed the BBIBP-CorV vaccine, a COVID-19 shot that was the nation's first approved for general use.

Known colloquially as the Sinopharm vaccine, the shot was one of the most widely administered COVID-19 shots in China, with an efficacy of 79% against hospitalization.

Apart from developing the Sinopharm shot, Yang was also the head of China's vaccine project under the 863 program, or Beijing's push to make the country more independent by developing homegrown advanced technologies.

Yang's dismissal has gone viral on Weibo, China's version of X, with thousands of posts questioning the circumstances behind his removal from deputy status. It received around 180 million views and, for several hours, was the platform's hottest topic on Sunday.

The discussion soon morphed into wild speculation that the reason behind his dismissal may have been related to the Sinopharm vaccine, though there has been no evidence to indicate as such.

"The father of the Sinopharm vaccine violated regulations and laws, but it doesn't mean there are problems with the vaccines he developed and produced," wrote "Dr Chen," a popular medical blogger. "Let's wait before panicking."

The announcement about Yang comes amid China's sweeping crackdown on corruption in its healthcare sector, with investigations launched against hundreds of hospital deans and secretaries.

It's been the heaviest disciplinary campaign ever enforced on China's healthcare industry, plagued for years by thousands of commercial bribery cases between pharmaceutical suppliers and healthcare providers.

In August, the anti-corruption campaign caused pharmaceutical A-share stocks in China to fall so sharply that it wiped out an estimated $27 billion market value within one day.

 

[Heliobas Disciple]

Targeted Enrichment and sequencing of BNT162b2 from OvCar3 cells

Optimizing sequencer efficiency

anandamide.substack.com

(fair use applies)


Targeted Enrichment and sequencing of BNT162b2 from OvCar3 cells
Optimizing sequencer efficiency
Anandamide
Apr 27, 2024

Sequencing can be expensive if you are looking for needles in a haystack. Often diploid human genomes are simply sequenced 30-90X coverage to get adequate sequence coverage of both maternal and paternal chromosomes. This usually equates to 600M 150bp Illumina reads (90Gbases) for a 30X coverage 3Gb genome or a 2B reads for a 90X 3Gb genome.

To sequence a diploid human genome, collections of 100,000s of cells are bulk DNA purified and sequenced with the assumption of the genomes from each cell being identical. This is a key assumption that doesn’t always hold true in cancer tissues, mosaic individuals or when you are hunting for variants that exist in only a subset of the 100,000 cells.

In the world of hunting for DNA integration, a small percentage of the cells are expected to be integrated and each integration event is likely to be unique to each cell. In these circumstances much higher sequencing coverage (10-100X more than a simple 90X coverage) is required to find such rare events (900-9,000 X coverrage). One publication made rather naive assumptions declaring no C19 viral integration exists after sequencing only to 54X coverage in diploid cells. This paper is less credible than the work performed by Rudi Jaenisch’s lab at the Whitehead Institute/MIT (Zhang et al) that employed methods to find rare events.


Smits et al uses low depth ONT to intentionally find nothing

Zhang et al used a method called TagMap (Stern et al) to find rare SARs-CoV-2 integration events into human cells. This looks like a very sensitive method but appears to require custom assembly of transposomes and some optimization of the transposon integration frequency.

The method relies on PCR, however, PCR requires 2 primers to amplify. When you have an integration event that could occur anywhere in the genome, what primers do you use? One primer has to be human and one primer has to be from the vaccine.


Figure 1 from Stern et al depicting TagMap

Ideally, you would use multiple primers from the vaccine as you can’t be certain which piece of the vaccine integrated nor where in the human genome it integrated.

TagMap, tags the genome with a transposon bombing reaction. If you integrate a transposon every ~2000 bases in the genome, you can use the transposon sequence as a PCR primer site and a spike primer as your 2nd primer in PCR.

You can’t over transposon bomb the genome (ie. 1 event ever 200bp) as you will just amplify transposon to transposon, so much care has to be taken to keep the transposon bombing frequency larger than the distance your PCR is optimized to amplify in hopes of only getting transposon to integration sites that can amplify.

Its a clever technique but use of a single spike primer will only find integration events from that region of spike and as a result it will have many blind spots.

Now that the entire vaccine plasmid sequence is known, we designed an alternative approach described in a previous article. This approach may also be used to enhance the TagMap approach.

Targeted Enrichment of vaccine DNA​

Anandamide
·
Apr 6

Lockdown probe designs IDT Lockdown Protocol In order to more efficiently search for genome integration events, we have designed a target enrichment system that can fish out DNA needles from a haystack. Target enrichment is something we do routinely at Medicinal Genomics. It is a method that …
Read full story

Briefly this method tiles the plasmid sequence with 113 biotinylated ‘bait’ probes that can hybridize any molecule out of the patient sample that has sequence similarity to the plasmid. These bait primers have to not hybridize to themselves so they cannot capture inverted repeats in the plasmid like the SV40 72bp enhancer.

To test this method we made a Whole Genome Shotgun library using a modified Watchmaker library construction kit. The one modification we employed was to add an additional 30 minute End Repair step (NEBnext End Repair kit #E6050S) to ensure the genomic DNA was fully end repaired and didn’t form chimeric ligations in the process of making Illumina Libraries. This approach is ultimately limited by the purity of the dATP used in the End Repair step. Any contamination with dTTP will result in T overhangs on the gDNA which can form chimeric fragments and chimeric reads.

Chimeric molecules in the library construction process were discussed in detail on previous threads. The % of chimeric reads is often noted on various library construction kits and will be an important topic as we try to assess the data that is enriched for BNT162b2 sequence.

For more information on library construction artifacts here are a few references. and Specs from Watchmaker

Results

The remainder of the BNT162b2 treated OvCar3 cells was converted into a whole genome shotgun library. This was sequenced to compare the number of reads that match BNT162b2 with and without the enrichment process.

We used the 16hr hybridization recommended for small targets in the IDT Lockdown protocol.



The coverage maps for the Run2 with enrichment (Top track sample 3) is nearly identical in shape as the unenriched sample (Middle track sample 2), how ever the coverage depth is ~600 time higher. Similar SNPs are seen in the plasmid (these are not seen when we sequence vaccines that have not touched cells). There is a small region of the plasmid that contained Mito Sequence on the right hand side of the middle track 2 (boxed in blue) that we didn’t tile with probes and hence doesn’t come through in the enrichment data.

We can see from the table above there are 2.9B reads in the unenriched sample and this only delivered 5.7K plasmid reads. Once the sample is enriched we have 717M reads with 32.7M plasmid reads. This is a 22,000 fold enrichment.

We did sequence this sample once before when the sample was freshly lysed and observed much higher plasmid coverage (106,000 X coverage). In the process of repeating this work to evaluate enrichment, we pulled those same lysed samples out of the freezer (after having been in lysis buffer for months) and made a new library out of the residuals from the tube. This delivered much lower (5.7K) plasmid coverage in the control but enriched to 32M reads.

Looking at this coverage in LOG scale provides demonstrates we are between 100,000X to 1M X coverage once the sample is enriched.



This is excellent enrichment and can reduce the sequencing costs required to find rare events significantly.

For those interested in these enriched reads you can find an excel sheet of all reads that map to BNT162b2 with one read and the OvCar3 genome with the other read here. Look a the 4th Tab over and you’ll see the data depicted in the table below.

You will note there are 18K read pairs in this 4th sheet and most of them are chimeric reads from the library construction process.

The reads we want to pay close attention to are reads that have a nearly full read length mapping to Human and a full read length mapping to BNT162b2.

You can identify the length of the mapping read by the CIGAR string in the column next to the blue box. 150M = 150bp Match. 4S146M = 4bp Softclip, 146bp Match. 146M4S = 146bp Match 4bp Softclip. These are alignment terms that depict how much of the read matches.

Of these reads which match near perfectly to each target we want to focus on loci that have reads mapping to the same general location with different start and stop points.

This means the 1st base and the last in the read which cover a loci of interest are offset compared to other reads covering the same region of interest.

This delivers you read pairs that are derived from different DNA molecules and can’t be chimera artifacts from the library construction process. Our previous substack on this topic goes over this chimeric read artifact and how to sift it apart with reads that have multiple start and stop points.



This ends up delivering DNA that is from spike on one read captured by lockdown probes 65-67. This happens to be one part of spike that contains a GP120-HIV motif.

CAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGTGCTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGATCC


and Human DNA that maps to chromosome 10.

TACGTGGGTCGCTCACCCCCGTGTATCCTGACATGAAGACACCTCCCGTTAGGGTCTAACATACACCTCATATAGGAGAGCTCTTGCTGGCATCTGGCAGGTGCCCCTCTCGGACAAAGCTTCCAGATGAAAGAACAGGCAGCACTCTTT



This maps to a region upstream of a lincRNA and down stream of an ENCODE Cis-regulatory element (CRE). See the center black block called YourSeq in the image below.


[continued next post]

 

[Heliobas Disciple]

[continued from above post]


Part of this human sequence is in a repetitive region that is conserved in Rhesus monkeys. The lincRNA in the neighborhood is a ‘gene' or transcript known as ENSG00000288526 (right upper green arrows)



This is also known as transcript uc057vaa.1 and its linked to some thrombocytopenia phenotypes.



Before we get too excited about these findings, it should be recognized that these are cancer cell lines given 100ul of Vaccine (1/3rd a dose) and we are not at a stage where we have eliminated all potential sequencing artifacts or confirmed these integration events with independent PCR in the original cells. We are in the process of ironing out all of the detection artifacts before we deploy this on real samples. Cell lines are the best place to sharpen that knife and we shouldn’t draw too many conclusions on integration rates with these data.

We have one more optimization that should occur. We have 18K chimeric BNT162b2 reads out of 717M) and a only a few that are candidates for integration events (have multiple start and stop point read pairs that support the event).

One way to clean up the chimeric read rate is to switch to a library construction process that is known to reduce these chimeric read events.

The current library construction process has a 3 step procedure where DNA is fragmented with DNase, End Repaired with a polymerase +dATP and then Adaptor ligated for sequencing. If this End Repair step fails for a few molecules, we can get genomic DNA ligating to plasmid DNA fragments thus creating false integration events. Since PCR is used after this step, these molecules can be amplified to create the false appearance of many reads (with the same start and stop points) that support a integration event.





This is why we demand multiple unique or distinct molecules (unique start and stop sites) supporting an integration event. Reads that have unique start and stop bases inform us that they were derived from different molecules and the odds of chimeric read formation occurring at the neighboring base in the genome is 1 in 3 billion. Unique start points are one mechanism of eliminating the noise from chimeric reads but there is a cleaner way to do this.

The solution to reducing the amount of chimeric read formation is to use enzymes that perform the fragmentation and ligation steps in a single enzymatic step. Transposons are ideal for this.

A process known as Tagmentation can achieve this and is known to reduce chimeric read events 10-100 fold. This is what Zhang et al used with their TagMap approach.



Now that we have the enrichment giving us a 22,000 fold boost in targeting putative integration events, we are also enriching for any BNT162b2 chimeric reads (artifacts) in the Library construction methods. These are library construction artifacts we can reduce with other methods.

We can clean this up 10-100 fold by using a library construction approach less prone to chimeric read formation. Instead of 18,000 read pairs to shift through, the Nextera transposon based library construction process should bring this down to 180-1,800.



Nextera Library of 2ul/100ul OvCar3.v2 P1 and P2. Derived from 32ng/ul or 64ng in total (6,400 cells)


Target enrichment of Transposon derived libraries should be able to reduce the required reads to detect integration events from ~50 Billion reads to just 100M-500M reads. This is similar to Zhang et al use of transposons but instead of using a single PCR primer to search for spike integrations, we are searching for all possible vaccine derived integration events. Recall, Zhang et al published before the vaccine plasmid sequence was known.

This should enable dozens of patients to be screened on a single Illumina lane.

Stay tuned

Now that we have the enrichment techniques optimized we should be able to screen samples that are more likely to find integration events.

One must keep in mind that we are currently screening a vaccinated cancer cell-line culture as an optimization sandbox and there is a survivor bias. The cells that were harmed by integration likely die and we fail to sequence them. Since they are cancer cells before we even apply vaccines, we cant expect the integration events to grow much faster than cells that already double very quickly.

If we sequence actual patient tumors with such an approach, we will flip this survivor bias on its head as we will be looking in cells that were vaccinated AND then transformed into fast growing cancer cells post vaccination. This should be more fertile ground to find integration events compared to a cell passage of cells that were already cancerous pre-vaccination where the most mutated cells likely die and fail to sequence.

---

These are 30Gb Fastq and BAM files. If you are interested in lightweight data, the 9mb Excel sheet is the best place to start.

Data files

Excel sheet

1.98 MB file on MEGA

mega.nz

OVCAR-P1-9715-xGEN_R2_001.fastq.gz

22.78 GB file on MEGA

mega.nz

R1 reads are still uploading at this time.

OVCAR-P1-9715-xGEN.bam

36.41 GB file on MEGA

mega.nz

 

[Heliobas Disciple]

Statement by Mike Yeadon

1. I, Mike Yeadon will say as follows. I have training in biochemistry and toxicology (1st class joint honours) followed by a research-based PhD in respiratory pharmacology. I then worked at increasingly senior levels in biopharmaceutical R&D (new medicines) and was vice president and worldwide...

drmikeyeadon.substack.com

(fair use applies)


Statement by Mike Yeadon
Dr Mike Yeadon
Apr 19, 2024

1. I, Mike Yeadon will say as follows. I have training in biochemistry and toxicology (1st class joint honours) followed by a research-based PhD in respiratory pharmacology. I then worked at increasingly senior levels in biopharmaceutical R&D (new medicines) and was vice president and worldwide head of allergy and respiratory at Pfizer. A position I left in 2011.After leaving my employment at Pfizer I took on work as a consultant to over 30 biotechnology companies and was very highly regarded both by investors and management. More recently I founded and led as CEO a biotech which was acquired by Novartis (2017).

2. I have a wide knowledge of the pharmaceutical industry, including all aspects of new medicine design, research, and development. In particular I have an in-depth knowledge of custom and practise in designing molecules likely to be safe, as well as of immunology and respiratory.

3. I provide the above outline of my credentials as evidence that as a senior former pharmaceutical company research executive I have the expertise and knowledge to make me a credible witness in speaking out about the grave concerns I have (concerns which are shared by others) about the alleged pandemic & countermeasures, especially the gene-based injections.

4. I have been raising these concerns now for a period of around for 3.5 years to date.

5. Overall it is my expert opinion that the injections purporting to be vaccines against an alleged virus (I say alleged, as no evidence has ever been provided of an isolated SARS-CoV-2 virus) are intentionally harmful, and as such must immediately be withdrawn from the market.

6. Below I will provide a short summary, which I have sought to make substantially non-technical, in explanation for why I have formed my opinion that that the injections as intentionally harmful and that as such they should be immediately withdrawn from the market.

7. However, before presenting my summary I will first make the following point, which I can substantiate.

8. In my view, the backdrop to this alleged “pandemic” is not a matter of medical and scientific issues, but a global crime scene of unprecedented scale and nature.

9. Claim 1: Choosing to invent, develop and manufacture a new vaccine is unquestionably the wrong response to a pandemic, even had the narrative presented to us not been false.

10. Given I have had an over 30-year career in “big pharma” and biotech, I knew that it was impossible to create a vaccine in under 5-6 years if they were going to demonstrate clinical safety and hone manufacturing to yield the customarily high-quality manufacturing necessary to produce tightly defined final drug product.

11. If this was not done, the product would be highly variable, and this is inherently dangerous. This is what has happened and the resulting variability of the product has completely invalidated any data obtained during toxicology and clinical development. In brief, the effect of overly expeditious development is that the product injected into literally billions of innocent men, women and children is not the same product as was used in the clinical trials.

12. No honest expert would even contemplate running a research program to bring forward a vaccine, because no pandemic in history has lasted a fraction of the minimum time necessary to create a safe and effective new vaccine. This timeline cannot be much shortened because a number of activities are performed in a stepwise manner, each step depending on the outcome of the preceding step.

13. In addition, we must consider the clinical context. We have been told of a public health emergency of international concern, where anyone could catch the virus and the elderly and already sick were particularly at risk of death. I believe this to be a deliberate deception, but even if we accept it, its vital to understand two things.

14. One, injected vaccines cannot and do not protect humans against acute respiratory illnesses believed to be due to respiratory viruses landing in the airways. This is because the immune response is primarily to stimulate the production of antibodies which circulate in the blood.

Antibodies are very large molecules and they are not able to leave the circulation and appear on the air side of the respiratory tract. In short, the product of the immune response to the vaccine and the virus itself do not meet, as they are in different bodily “compartments.”

15. Two, the very people we were told are particularly at risk, the elderly and sick, are in part, in this vulnerable state because their senescent immune systems respond poorly to new infectious disease threats. Why would anyone expect a good response to an injected vaccine? This is said to mimic a new infectious disease threat. It is important to note something very little known by the public but injected “flu vaccines” do not work. They do not reduce hospitalisation or death in the elderly. Yet flu vaccines have been promoted as a vital public health measure for decades and are paid for by taxpayers. Furthermore, even flu vaccines can lead to adverse events, sometimes serious, but this is not compensated by an expectation of protection against a threat to health, namely influenza. Now you know this, you may find it rather less difficult to believe that this industry is willing to lie and deceive in order to reach its objectives.

16. I have outlined why it is impossible to produce a safe and effective vaccine in much less than 5-6years, yet we are asked to accept that this has been accomplished in less than one year. I have also described why it is that an injected vaccine could not work, even if it was safe, in the setting we are told exists. Yet they went ahead. This is malevolent, as I will show.

17. Claim 2: Gene-based vaccines were advanced as the exclusive solution, but was a means to misuse the reduced regulatory hurdles for conventional vaccines in order to push gene therapies onto the market.

18. Vaccines have been developed and used against an increasing range of infectious disease targets rather widely since the middle of the 20th century and some are much older. Every vaccine until the covid pandemic era has involved taking a sample of the disease-causing agent and formulating it for injection or instillation into the airway. This has the advantage that the amount of pathogen is known and fixed. In many ways, this process mimics what we are told is a similar process to when we are infected by the wild pathogen. Many vaccines have been developed and marketed and over many decades, the makers, the regulators, doctors, and the public have acquired a common understanding of what kind of product these are and how to evaluate them. This is the background that has led to the regulatory pathway for their development. In certain regards, it has been appropriate to truncate or not even to study certain properties of “conventional vaccines” because they are uninformative and do not contribute anything to evaluation of the agent.

19. The preparations called vaccines in this alleged pandemic are in no way like these older products. Instead, these are gene-based agents, which commandeer the recipients’ cells to manufacture whatever is encoded in the gene sequence. This is a crucial difference, as I will exemplify later. But it is important to understand that there are additional steps in the biological response to gene- based agents as compared to old-style vaccines. Old style vaccines do not travel far from the injection site. The materials injected are suspensions, small pieces of cells and killed or weakened infectious agents. Our bodies are well-adapted to recognise that foreign materials have arrived and have evolved to respond appropriately to this event. The gene-based injections, by contrast, can and do travel all over the body, prompted to make foreign proteins in anatomical locations where the pathogen would be unable to reach, such as the brain.

20. Gene-based treatments are often called by a slang term “gene therapies.” This is an imprecise term and causes much argument, since it is often stated that they do not modify ones’ genes. That is not relevant. What is relevant is that it is a gene that is at the heart of the treatment. A gene is simply a code for the manufacture of a protein. These mRNA-based agents ARE, however, classified by their manufacturers as “gene therapies” for the purpose of describing to investors the nature of the development and commercial risks being run. Rightly so, for none of these products had reached the market by 2020, though there had been a number of unsuccessful attempts.

21. I first encountered the idea of mRNA-based therapeutics in the late-1990s, when I led respiratory research for Pfizer. I could see a potential clinical utility only in life-threatening, inoperable cancers that were unresponsive to chemotherapeutics and radiotherapy. Somewhat of a niche opportunity only.

22. The reason they were perceived to have some use in this narrow but important application is vital to understand, if I am to explain clearly why I am so sure that these are wholly inappropriate to protect against an alleged respiratory virus. The original idea was that a piece of genetic code coupled to something else that would enable the preparation to travel to and be taken up by the remote tumour. The cells making up that tumour would copy the genetic code and make whatever protein was encoded. Because that protein was foreign, and not normally made by humans, our immune systems would recognise that we had something foreign inside us and this would stimulate a lethal attack upon every cell that had taken up and followed the genetic instructions. This is a branch of what is called “immunooncology” and a number of companies have tried to develop such “gene therapies” as anti-cancer agents, so far without success. The crucial point to remember is that these preparations were expected to work by precipitating lethal immune attack on every cell that had taken it up.

23. Returning to the development pathway for these agents. Because they are new and unprecedented, the medicines regulators around the world have laid down onerous conditions for their development. Obviously, they are potentially very potent medicines and being new, great care was to be taken to avoid predicted as well as unanticipated harms. With new types of medical treatment, while some potential harms can be anticipated and characterised properly, other harms may arise which were not expected. This is why the development pathway for new types of powerful medical interventions are given especially tough review.

24. I now make an important point. In 2020, we are told that at least four biopharmaceutical companies decided to develop gene-based vaccines. As I explained earlier, conventional vaccines are given a somewhat easier time of it in relation to developmental obligations. Despite classifying to the financial markets their own products as “gene therapies” & subject to lengthy and expensive development obligations, they persuaded the medical regulators (and deceived the public) to classify them as “vaccines”. This was improper and was accompanied by bodies such as WHO and even dictionary makers to change the definition of the word vaccine to facilitate this deception.

25. Deception matters not because of mere naming conventions, but because the manufacturers knew that vaccines are much lighter in terms of development obligations. Even given this improper advantage, the makers of the gene-based vaccines failed to meet all, of even the relatively light development obligations. The end result has been billions of people being injected with mis-classified and inadequately tested gene-therapies. The adverse effect profiles and deaths as a consequence are extraordinary yet are being ignored by multiple bodies tasked with vigilance in patient safety. None of this can be constructed as accidental or inadvertent.

26. Claim 3: The design choices made in constructing the gene-based agents purporting to be vaccines are evidence of intentional harms.

27. Medicinal preparations contain molecules that were chosen by its designers. Nothing is in them that was not thoughtfully included. My career has been wholly within the sphere of endeavour called “rational drug discovery” or “rational drug design”. My main responsibility was to select biological targets for intervention with a chemical or a biological molecule, the latter usually being designed by more than one person. I was part of the design teams for decades. Our objective was to reach and interact with the molecular target, hoping to bring about desirable effects in patients, and to do so without inducing unacceptable unwanted effects, taking into account the seriousness of the illness at issue.

28. My contention is that, by close examination of the products of such design teams, I can, at least in part, deduce the intentions of the designers. It gives me no pleasure to lay out below several features of the design of the mRNA “vaccines” from Pfizer / BioNTech and from Moderna, ALL of which predictably give rise to toxicity. The features of interest are common to both products. There is no reasonable conclusion to this analysis other than that the designers intentionally created products which would be expected to cause harms including death and sterility.

29. Designed-in toxicity 1: axiomatic induction of “autoimmune” responses, regardless of what the genetic sequence codes for. As described earlier about how immunooncology was considered the leading application, when our bodies manufacture a foreign or non-self-protein, our immune system recognises this as a threat and mounts a lethal attack on every cell performing the genetic instruction. In short, wherever in the body these materials travel after injection into the upper arm, the immune system will destroy those cells and tissues. I believe it is very likely that the reported extensive range of adverse effects is due to this common process, autoimmune destruction, occurring in all kinds of tissues around the body. This is expected. Anyone with a basic knowledge of immunology knows this.

30. Designed-in toxicity 2: The next was choice of the gene chosen. I believe selecting the spike protein of the alleged coronavirus is irrational, because it was highly likely to be directly toxic. These surface proteins are known from comparison to related pathogens to be toxic to blood, initiating blood clots and damaging the function of nerve cells. Not only is it very dangerous to force human bodies to manufacture a pro-coagulant protein, it was unnecessary. There are several alternative genes that a safety-orientated designer would choose from.

31. In addition to the toxicity of spike protein, spike is, we are informed, subject to the most rapid mutation (so a vaccine might lose efficacy quickly) and also it is the least different from human proteins (and so might trigger bystander attacks on even somewhat similar self-proteins).

32. Yet all four leading players chose spike protein as their genetic coded antigen. What a coincidence! If I had been in one of the roles leading these efforts, I would ’have called up my peers in the other companies to ensure we did not do that. That is because from a strategic standpoint, it would be highly undesirable to have common risks to all programs.

33. Designed-in toxicity 3: On formulation, the teams developing mRNA-based products both selected lipid nanoparticles (LNPs) to encapsulate their genetic message. Yet there was industry knowledge that these not only travel all over the body including into the brain but that they accumulate in the ovaries. Yet, knowing this, the companies and regulators went ahead and then others compounded the toxicity risk by recommending these injections in pregnant women and children.

34. This is not an exhaustive list and I am aware of further toxicity liabilities. I felt three was an adequate number to exemplify my concerns. Remember, please, that these agents are not expected to yield benefits as explained earlier and have been developed at a pace completely inconsistent with normal practise, absolutely required to result in a consistent product.

35. I am very confident of this conclusion. I have said so in more than 100 video interviews which have been viewed millions of times, despite the obvious efforts of censors. If these claims were completely wrong, I expected to have been corrected years ago and at least injuncted not to repeat the claims.

36. I know all the companies are aware of my views, because I sadly know three of the four individuals responsible for R&D on vaccines and I have written to them laying out my concerns. Not one replied, though one resigned a few months later without giving a reason, which is extraordinarily uncommon, because it results in forfeiture of very substantial deferred compensation.

37. Claim 4: The evolution of the target population, from initially only the elderly, eventually to everyone is confirmatory evidence of intentional harm.

38. This is simple to explain, but it is worth laying out. Recall at first, we were told that those most at risk from this alleged virus were the elderly who were already sick. Consistent with this, the first cohorts of the public invited to receive these injections were the over 60s.

39. Over a period of months, the threshold age for receiving the injections fell and continued to fall until healthy youngsters were being pressurised to get injected even though they had essentially no risk of death from the alleged virus.

40. Along the way, and outside of medical practise of 60 years standing, pregnant women were encouraged to get injected, too. There is no evidence that they were at risk. Even if they had been, it has been policy NEVER to expose pregnant women to novel medical treatments, because of the risks to the developing baby. The watershed event was thalidomide and this awful event set a firm, never breached red line not to allow risky interventions in pregnancy. Until 2021, when this red line was driven right over without comment. The manufacturers had not then even completed regulatory reproductive toxicology. They had absolutely no information, yet women were told it was safe, when in fact it was not.

41. Finally, children were called to be injected, even though the authorities had previously told us that children were at no risks from the alleged virus.

42. In conclusion there are several, completely obvious safety issues built into these products. This is intentional.

43. I was still slow to piece together all this evidence of carefully thought-out harms. But eventually I got there are and have been speaking in what many regard as extreme terms ever since.

 

[Heliobas Disciple]

Is the spike protein of KP.2 adorned with additional glycan chains?

Recently, it has been described how the SARS-CoV-2 (SC-2) KP.2 variant (JN.1.11.1.2) is capable of rapidly gaining ground on the hitherto predominant 'parent' variant, namely JN.1 (itself descending from BA.2.86; https://www.biorxiv.org/content/10.1101/2024.04.24.590786v1

voiceforscienceandsolidarity.substack.com

(fair use applies)


Is the spike protein of KP.2 adorned with additional glycan chains?
Geert Vanden Bossche
Apr 28, 2024

Recently, it has been described how the SARS-CoV-2 (SC-2) KP.2 variant (JN.1.11.1.2) is capable of rapidly gaining ground on the hitherto predominant 'parent' variant, namely JN.1 (itself descending from BA.2.86; | bioRxiv fig. 1). This evolution sharply contrasts with the trend observed so far, namely that the fitness advantage of new JN.1 descendants is not strong enough to sufficiently displace JN.1, thus causing different, more transmissible JN.1 variants to consecutively emerge (How things could change... ("Het kan verkeren"…) | Voice for Science and Solidarity).

According to the concept illustrated in fig. 2 below, which depicts the shift from virus internalization into antigen-presenting cells (APCs) to virus adsorption onto APCs, heightened virus adsorption onto migratory dendritic cells (DCs), coupled with KP.2's enhanced resistance to binding by vaccine-primed potentially neutralizing antibodies (pNAbs), diminishes cytotoxic T lymphocyte (CTL) activation and thus reignites virus spread. This would enable SC-2 variants showing an increased degree of glycosylation to promote their transmission. This is because increased glycosylation of viral surface proteins, for example, the spike (S) protein, can enhance binding of glycosylated viruses to lectins[1] expressed on the surface of DCs. The reinforced interaction of the virus with lectins expressed on DCs will only increase the adsorption of progeny virions and thus the immune pressure on the non-neutralizing polyreactive antibodies (PNNAbs) [https://www.voiceforscienceandsolid...og/i-can-now-spot-the-tsunami-at-the-horizon; JN.1 quasispecies | Voice for Science and Solidarity].

Despite the fact that additional virus glycosylation likely hampers intrinsic viral infectiousness, it is still possible that increased viral transmission will ultimately result in increased viral fitness of KP.2 relative to JN.1. This indeed seems plausible, as additional glycosylation is likely to further reduce viral susceptibility to binding by pNAbs. Furthermore, because of their increased adsorption on DCs, the intrinsic infectiousness of JN.1 progeny virions is constrained as well.

The above-described dynamics of virus evolution and spread could explain the appearance and increasing spread of KP.2: “The escalating variant frequency of KP.2 underscores the variant’s ability to outcompete existing lineages and establish itself as a significant contributor to the ongoing pandemic dynamics” (https://www.thailandmedical.news/ne...ariants-behind-spring-s-silent-covid-19-surge).

As far as I am aware, the glycosylation profile of KP.2 has not yet been reported. However, it is evident that despite its significantly reduced intrinsic infectiousness (i.e., compared to JN.1), KP.2 exhibits a clear competitive advantage in terms of its spread. Nonetheless, I believe that the fitness advantage of KP.2 will ultimately prove insufficient to ensure the virus's continued dissemination. Therefore, I feel very concerned that the KP.2 variant will soon be replaced by a new coronavirus (CoV) lineage, in which the S protein's glycosylation will fully overcome the virulence-inhibiting effect of PNNAbs. Only then will the virus regain an effective growth advantage. However, this dramatic increase in viral replication will primarily occur within infected hosts rather than through inter-host transmission.

In conclusion, it is crucial to investigate KP.2's glycosylation profile to better understand its unique virological behavior and determine whether KP.2 could herald the emergence of a new CoV lineage with enhanced virulence potential for COVID-19 vaccine recipients. Regardless of the underlying structural changes in the S protein, it seems likely that KP.2’s ability to establish itself as a significant contributor to the JN.1 quasispecies population suggests the virus's readiness to undergo a dramatic structural and functional transformation (JN.1 quasispecies | Voice for Science and Solidarity). This readiness could precipitate the sudden emergence of a new CoV lineage, namely HIVICRON, capable of inducing a significant surge in enhanced severe disease across highly COVID -19 vaccinated populations.

[1] Lectins are proteins that can bind specifically to certain carbohydrate structures present on the surface of pathogens, such as viruses.

Fig. 1:

Fig. 2:

Early Omicron descendants enter target host cells via PNNAb-dependent enhancement of infection (?). PNNAbs bind to progeny virus tethered to these DCs, which subsequently migrate to the lungs and other distal organs (). On the other hand, previously SIR-primed Abs bind with low-affinity to the antigenically more distant immune escape variant, thereby generating Ab-virus complexes that are taken up into patrolling APCs (?). Enhanced uptake of large Ab-virus complexes into APCs facilitates strong activation of CTLs, thereby enabling the elimination of virus-infected host cells.

Highly infectious Omicron descendants do not rely on PNNAb-dependent enhancement of infection to enter target host cells. Replication of highly infectious variants generates an immunological environment that promotes their adsorption onto tissue-resident DCs. Due to their high level of intrinsic infectiousness, newly emerging, more transmissible Omicron descendants (e.g., members of the JN.1 clan) will therefore enhance the adsorption of progeny virions on migratory DCs and thereby reduce viral uptake by APCs. Reduced viral uptake by APCs will promote the priming of CD4+ T cells. Some of these T cells may be self-reactive, while others are foreign-centered but fail to serve as T helper cells to assist in boosting of previously SIR-primed Abs due to a lack of immune recognition of the corresponding S-associated B cell epitopes comprised within large Ab-coated virus complexes. Diminished boosting of previously primed anti-S Abs results in diminished production of PNNAbs.

As these more infectious and inflammatory variants (i.e., the JN.1 clan) steadily increase in prevalence, diminished production of PNNAbs, combined with their enhanced binding to highly infectious DC-tethered progeny virions leads to a steadily increasing immune pressure on viral virulence in highly Covid-19 (C-19) vaccinated populations. This is thought to eventually trigger the selection of a new Coronavirus lineage that has the capacity to cause PNNAb-mediated enhancement of vaccine breakthrough infections in highly C-19-vaccinated populations, thereby causing a massive wave of enhanced severe C-19 disease.

 

[Heliobas Disciple]

The reason I post bird flu articles on this thread is because right now it's just a 'threat' and if it does manifest (and it might not), it's going to be Covid part 2 as far as gov't reaction, etc. So a lot of what we've been discussing for the last 4 years on this therad will be very relevant, as well as home remedies and prophylactics, etc. And also because it could be exacerbated by the manipulation of the immune system of vaccinees. Right now I'm not convinced H5N1 transmitted between humans is going to be Disease X. It certainly could be, but we have to wait and see. There certainly is a lot of news coverage of it, but that could be 'watch the left hand while the right hand is busy doing something else' distraction.

~~~~~~~~~

Dairy farmers are at risk for bird flu. Here's how they can stay safe.

Experts maintain the milk supply is safe. Their focus is on keeping the people who work with cows from getting sick.

www.nbcnews.com

(fair use applies)


Bird flu cases are likely being missed in dairy workers, experts say
Experts maintain the milk supply is safe. Their focus is on keeping the people who work with cows from getting sick.
By Erika Edwards
April 26, 2024, 11:06 PM UTC

Dr. Barb Petersen, a dairy veterinarian in Amarillo, Texas, had been caring for sick cows for several weeks in March when she and a colleague finally pinned down the cause of the illness among the herd: the H5N1 strain of the bird flu.

It was the first time the virus had been detected in cattle.

The sick cows, said Petersen, who owns Sunrise Veterinary Service, tended to produce milk that didn’t look quite right, and had mastitis, an inflammation of the udders.

During that same time, she said, dairy workers — including those who were never in close contact with the sick cows — also fell ill.

“People had some classic flu-like symptoms, including high fever, sweating at night, chills, lower back pain,” as well as upset stomach, vomiting and diarrhea, Petersen said. “They also tended to have “pretty severe conjunctivitis and swelling of their eyelids.”

Petersen noted that the people were never tested for H5N1; it’s possible that their symptoms were the result of another illness.

Since the outbreak in cows was announced in late March, bird flu has been detected in 33 dairy herds in nine states: Colorado, Idaho, Kansas, Michigan, New Mexico, North Carolina, South Dakota, Ohio and Texas.

So far just one person, a dairy worker in Texas, has tested positive for the virus. The person’s case was mild, the Centers for Disease Control and Prevention said. The only symptom involved was conjunctivitis, or pinkeye.

At least 44 others may have been exposed, the CDC said. Some have been tested, while others were asked to monitor symptoms, such as cough, sore throat, pinkeye, fever, headache and diarrhea.

Dr. Keith Poulsen, director of the Wisconsin Veterinary Diagnostic Laboratory, said he’s heard reports of flu-like illnesses on affected dairy farms.

“It’s certainly not a large amount,” he said, “but there’s probably a lot of cases that are not documented.”

Several factors may prevent sick dairy workers from seeking medical care or farmers from even reporting a positive case among their cattle.

Farming, especially in rural areas with fewer medical centers, is often a 24/7 job without the benefit of sick days. What’s more, false information circulating across farming communities is fueling a tremendous amount of fear that dairy farmers could lose their livelihood if they are tagged as harboring H5N1, Poulsen said.

“The biggest concern that we hear our dairy farmers say is, ‘I don’t want to test because they’re going to depopulate my herd,’” he said. “Misinformation out there is really challenging because that’s really not the case.”

“Our job right now is to protect farmworkers,” said Jennifer Nuzzo, director of the Pandemic Center at Brown University School of Public Health. “We can’t do that unless we know where the virus is or where it isn’t.”

It’s still unclear how the bird flu virus spreads from cows to people, though some experts said it could be through multiple paths, such as contact with milk, contaminated milking equipment, or even respiratory droplets.

“I think everything’s on the table at this point,” said Dr. Andrew Bowman, a veterinary epidemiologist at the Ohio State University.

On Thursday, the Food and Drug Administration said that genetic traces of the virus have been detected in 1 in 5 samples of pasteurized milk.

Preliminary results announced Friday by the agency said that pasteurization kills the virus, adding that the testing “did not detect any live, infectious virus” in commercially sold milk. The FDA said it was testing 297 samples from 38 states.

The FDA said it had also tested several powdered infant and toddler formulas and found no evidence of bird flu virus. It was unclear how many formula samples the agency had tested.

Meanwhile, experts recommend that anyone in contact with dairy cattle wear protective equipment, including safety glasses or goggles, waterproof aprons and boots that can be sanitized.

Poulsen encouraged dairy farmers to be as up front as possible about the virus. The more time it has to replicate in cows and other mammals, the stronger it might become, he said.

“The longer that we let this go unchecked or uncontrolled,” he said, “it becomes a much, much bigger problem that could make Covid look easy.”

 

[ktrapper]

https://media.mercola.com/ImageServer/Public/2024/April/PDF/prion-brain-diseases-pdf.pdf

Doctors Predict Epidemic of Prion Brain Diseases
Analysis by Dr. Joseph Mercola April 29, 2024


STORY AT -A-GLANCE
According to mounting data, one of the more serious side effects of the COVID mRNA
jabs appears to be dementia, and worse yet, this previously untransmissible disease
may now be “contagious, ” transmissible by way of prions.
In my 2021 interview with Stephanie Seneff, Ph.D., she explained why she suspected the
COVID shots may eventually result in an avalanche of neurological prion-based diseases
Doctors Predict Epidemic of Prion Brain Diseases
Analysis by Dr. Joseph Mercola April 29, 2024
Mounting research suggests a serious side effect of the COVID mRNA jabs could be
dementia, and the prions that cause it may be contagious

Frameshifting, as we now know occurs in the COVID shots, can induce prion production
and lead to neurodegenerative diseases such as Alzheimer’s and Creutzfeldt-Jakob
disease (CJD)

Sid Belzberg's prions.rip website, which collected data on neurological side effects post-
jab, found a notably high incidence of diagnosed CJD cases, suggesting an alarming
trend

A series of articles highlight biases in clinical trials and observational studies, suggesting
COVID-19 vaccines' safety and effectiveness have been massively overstated

The Global COVID Vaccine Safety Project study — funded by the U.S. Centers for Disease
Control and Prevention — reveals significant side effects, including myocarditis,
pericarditis, and blood clots, underscoring the need for reevaluation of COVID vaccine
risks and benefits

such as Alzheimer’s. She also published a paper detailing those mechanisms in the May
10, 2021, issue of the International Journal of Vaccine Theory. As she explained in that
paper:
“A paper published by J. Bart Classen (2021) proposed that the spike protein in
the mRNA vaccines could cause prion-like diseases, in part through its ability to
bind to many known proteins and induce their misfolding into potential prions.
Idrees and Kumar (2021) have proposed that the spike protein’s S1 component
is prone to act as a functional amyloid and form toxic aggregates ... and can
ultimately lead to neurodegeneration. ”
In summary, the take-home from Seneff’s paper is that the COVID shots, offered to
hundreds of millions of people, are instruction sets for your body to make a toxic protein
that will eventually wind up concentrated in your spleen, from where prion-like protein
instructions will be sent out, leading to neurodegenerative diseases.
What Are Prions?
The term "prion" derives from "proteinaceous infectious particle. " Prions are known to
cause a variety of neurodegenerative diseases in animals and humans, such as
Creutzfeldt-Jakob disease (CJD) in humans, bovine spongiform encephalopathy (BSE or
"mad cow disease") in cattle, and chronic wasting disease in deer and elk.
These diseases are collectively referred to as transmissible spongiform
encephalopathies (TSEs). They’re characterized by long incubation periods, brain
damage, the formation of holes in the brain giving it a sponge-like appearance, and
failure to induce an inflammatory response.
“Infectious prions propagate by transmitting their
misfolded protein state to normal variants of the same
protein.”
1
In short, prions are infectious agents composed entirely of a protein material that can
fold in multiple, structurally distinct ways, at least one of which is transmissible to other
prion proteins, leading to a disease that is similar to viral infections but without nucleic
acids.
Unlike bacteria, viruses, and fungi, which contain nucleic acids (DNA or RNA) that
instruct their replication, prions propagate by transmitting their misfolded protein state
to normal variants of the same protein.
According to the prion disease model, the infectious properties of prions are due to the
ability of the abnormal protein to convert the normal version of the protein into the
misfolded form, thereby setting off a chain reaction that progressively damages the
nervous system.
Prions are remarkably resistant to conventional methods of sterilization and can survive
extreme conditions that would normally destroy nucleic acids or other pathogens, which
is part of why prion diseases are so difficult to treat.
More Evidence mRNA Shots Can Trigger Dementia
Today, there’s even more evidence to support Seneff’s theory. In August 2022, tech
entrepreneur Sid Belzberg wrote about prions.rip, a website he’d set up to collect data
on the neurological side effects of the jabs. (This site is no longer live.)
Within a few months, the site had received about 15,000 hits and gathered 60 reports
from people who got the jab and suffered neurological deficits shortly thereafter,
including six cases of diagnosed CJD.
“Normally this disease affects 1 in a 1,000,000 people, ” Belzberg wrote. “To get
6 cases you would need 6,000,000 hits to the site assuming everyone reports.
The chances of getting 1 case in 15,000 hits is 1 in 66. To see 6 cases in 1
group of 15,000 is 1/66^6 or 1 in 82,000,000,000, or 20 times more likely to win
a Powerball lottery! ...
2
3
To reiterate, CJD is an exceptionally rare disease that is now a known and
established severe adverse reaction (SAE) from the DEATHVAX™. Injecting this
slow kill bioweapon can cause ailments that are about as likely to develop in the
real word as getting struck by lightning twice. The proof is now irrefutable. ”
Frameshifting Can Result in Prion Production
In mid-December 2023, researchers reported that the replacing of uracil with
synthetic methylpseudouridine in the COVID shots — a process known as codon
optimization — can cause frameshifting, a glitch in the decoding, thereby triggering the
production of off-target aberrant proteins.
The antibodies that develop as a result may, in turn, trigger off-target immune reactions.
According to the authors, off-target cellular immune responses occur in 25% to 30% of
people who have received the COVID shot. But that’s not all.
According to British neuroscientist Dr. Kevin McCairn, this frameshifting phenomenon
has also been linked to harmful prion production — and that frame shifted prions,
specifically, are infectious and can be transmitted from one person to another. As
reported in the Journal of Theoretical Biology in 2013:
“A quantitatively consistent explanation for the titres of infectivity found in a
variety of prion-containing preparations is provided on the basis that the
etiological agents of transmissible spongiform encephalopathy comprise a very
small population fraction of prion protein (PrP) variants, which contain
frameshifted elements in their N-terminal octapeptide-repeat regions ...
Frameshifting accounts quantitatively for the etiology of prion disease. One per
million frameshifted prions may be enough to cause disease. The HIV TAR-like
element in the PRNP mRNA is likely an effector of frameshifting. ”
McCairn explained this mechanism in a February 19, 2023, interview with Health
Alliance Australia (video above). In it, he noted:
4,5,6
7
“Mis-folded proteins caused by prions can impact every level organ and tissue
system in the body ... [They] bioaccumulate and are resistant to degradation,
thereby building up ... ”
Prions may in fact be the primary molecule that is being “shed” by COVID jab recipients,
and if those prions are due to frameshifting, that could be very bad news indeed,
considering their implication in dementia.
Another doctor who believes we’ll be facing an “epidemic of prion disease” is Dr. David
Cartland. In late February 2024, he posted 13 scientific papers linking the COVID jabs,
prion diseases and CJD, noting that was just a “small selection” of what’s available in the
medical literature.
Prions Implicated in Long COVID as Well
According to genomics expert Kevin McKernan, Ph.D., prions are also involved in long
COVID (or as McKernan calls it, “long vax”). In one 2024 study, 96.7% of long COVID
sufferers had received the jab. In an interview with the Front Line COVID-19 Critical Care
Alliance (FLCCC), McKernan stated:
“If you frameshift over the stop codons, you’re going to be making proteins that
are spike-mito proteins. When I talk to a lot of the long vax patients I hear of all
these things that remind me of my time in the mitochondrial disease
sequencing space ... ”
McKernan claims he tried to publish a paper on this in 2021 with Dr. Peter McCullough,
but the editor of the journal “stepped in and torpedoed the paper.
”
World’s Largest Side Effect Analysis Has Been Published
In related news, the largest study to date on the side effects of the COVID jabs was
published in the journal Vaccine in February 12, 2024, and it confirms what I and many
8
9 10
11
12
13
other alternative news sources have been saying all along, namely that the mRNA jabs
are the most dangerous medical products to ever hit the market.
The study — performed by the Global COVID Vaccine Safety (GCoVS) Project and funded
by the U.S. Centers for Disease Control and Prevention, Public Health Ontario and the
Canadian Health Research Institute — evaluated the risk of "adverse events of special
interest" (AESI) following COVID-19 “vaccination. ”
Data from 10 sites in eight countries (Argentina, Australia, Canada, Denmark, Finland,
France, New Zealand and Scotland) were included, encompassing more than 99 million
jabbed individuals.
Of the thousands of side effects Pfizer listed in its confidential report of post-
authorization adverse events submitted to the U.S. Food and Drug Administration, the
GCoVS focused on 13 AESIs that fall into three primary categories: Neurological,
hematologic (blood-related) and cardiovascular conditions.
They calculated the AESI risk for each of the 13 AESIs based on the number of observed
versus expected (OE) incidents occurring up to 42 days after injection. The “expected”
number of side effects were based on vaccine adverse event data from 2015 to 2019.
These rates were then compared to the adverse event rates observed in those who got
one or more of the COVID jabs, either Pfizer's BNT162b2, Moderna's mRNA-1273, or
AstraZeneca's ChAdOx1.
Largest Study to Date Confirms COVID Jab Dangers
The analysis revealed several concerning side effects, including increased risks of
myocarditis, pericarditis, blood clots in the brain, and various neurological conditions.
Here’s a quick summary of the findings:
• Myocarditis and pericarditis:
◦ Pfizer vaccine — OE ratios for myocarditis were 2.78 and 2.86 after the first
and second shots, with the risk remaining doubled after the third and fourth
14
15
shots.
◦ Moderna vaccine — OE ratios for myocarditis were 3.48 and 6.10 after the first
and second shots. Doses 1 and 4 also showed OE ratios of 1.74 and 2.64 for
pericarditis.
◦ AstraZeneca vaccine — OE ratio for pericarditis was 6.91 after the third shot.
• Blood clots in the brain (cerebral venous sinus thrombosis, CVST):
◦ An OE of 3.23 for CVST was observed after the first AstraZeneca shot.
◦ A significant increase in CVST risk was also noted after the second Pfizer dose.
• Neurological conditions:
◦ Guillain-Barré syndrome — An OE ratio of 2.49 was observed following the
AstraZeneca jab.
◦ Transverse myelitis — Risk nearly doubled with the AstraZeneca shot.
◦ Acute disseminated encephalomyelitis — OE ratios of 3.78 (Moderna) and 2.23
(AstraZeneca) were noted.
These findings really underscore the potential for serious side effects from the COVID
shots, including conditions that may lead to other consequences in the longer term,
such as stroke, heart attack, paralysis and death.
Effectiveness and Safety Was Wildly Exaggerated in Trials
Considering those findings, it’s no surprise to find that effectiveness and safety were
exaggerated in clinical trials and observational studies. In a guest post on Dr. Robert
Malone’s Substack, Raphael Lataster, Ph.D., writes:
“An unofficial series of four crucially important medical journal articles, two by
me, appearing in major academic publisher Wiley’s Journal of Evaluation in
Clinical Practice reveals that claims made about COVID-19 vaccines’
16
effectiveness and safety were exaggerated in the clinical trials and
observational studies, which significantly impacts risk-benefit analyses.
Also discussed are the concerning topics of myocarditis, with evidence
indicating that this one adverse effect alone means that the risks outweigh the
benefits in the young and healthy; and perceived negative effectiveness, which
indicates that the vaccines increase the chance of COVID-19
infection/hospitalization/death, to say nothing about other adverse effects. ”
Summary of Papers
The four papers in question include:
1. “Sources of Bias in Observational Studies of COVID-19 Vaccine Effectiveness”
published in the Journal of Evaluation in Clinical Practice in March 2023, co-
authored by BMJ editor Peter Doshi, Ph.D., statistician Kaiser Fung and
biostatistician Mark Jones, which concluded that “case-counting window bias” had
a significant effect on effectiveness estimates.
As explained by Lataster, this “concerns the 7 days, 14 days, or even 21 days after
the jab where we are meant to overlook jab-related issues, such as COVID
infections, for some odd reason as ‘the vaccine has not had sufficient time to
stimulate the immune system. ’
This may strike you as quite bizarre since all of the ‘fully vaccinated’ must go
through the process of being ‘partially vaccinated, ’ sometimes even more than once.
To make matters worse, the unvaccinated do not get such a ‘grace period, ’ meaning
that there is also a clear bias at play.
In an example using data from Pfizer’s clinical trial, the authors show that thanks to
this bias, a vaccine with effectiveness of 0%, which is confirmed in the hypothetical
clinical trial, could be seen in observational studies as having effectiveness of 48%. ”
17
2. “Reply to Fung et. al. on COVID-19 Vaccine Case-Counting Window Biases
Overstating Vaccine Effectiveness, ” authored by Lataster, which discussed how the
counting window bias not only affected effectiveness estimates in observational
studies but also safety estimates, suggesting a need for reassessment of vaccine
safety. The article also addresses “the mysterious rise in non-COVID excess
deaths post-pandemic. ”
3. “How the Case Counting Window Affected Vaccine Efficacy Calculations in
Randomized Trials of COVID-19 Vaccines, ” again co-authored by Doshi and Fung,
which detailed how case-counting window issues also overestimated effectiveness
in Pfizer and Moderna clinical trials.
4. A second article by Lataster, in which he highlighted and summarized the evidence
showing that clinical trials were affected by adverse effect counting window issues
that led to exaggerated safety estimates.
“Together, these four articles make clear that claims made about COVID-19 vaccines;
effectiveness and safety were exaggerated in the clinical trials and observational
studies, whilst also finding time to discuss myocarditis and perceived negative
effectiveness, meaning that new analyses are very much needed, ” Lataster writes.
Resources for Those Injured by the COVID Jab
Based on data from across the world, it’s beyond clear that the COVID shots are the
most dangerous drugs ever deployed. If you already got one or more COVID jabs and are
now reconsidering, you’d be wise to avoid all vaccines from here on, as you need to end
the assault on your body. Even if you haven’t experienced any obvious side effects, your
health may still be impacted long-term, so don’t take any more shots.
If you’re suffering from side effects, your first order of business is to eliminate the spike
protein — and/or any aberrant off-target protein — that your body is producing. Two
remedies shown to bind to and facilitate the removal of SARS-CoV-2 spike protein are
hydroxychloroquine and ivermectin. I don’t know if these drugs will work on off-target
proteins and nanolipid accumulation as well, but it probably wouldn’t hurt to try.
18
19
20
21
22
The Front Line COVID-19 Critical Care Alliance (FLCCC) has developed a post-vaccine
treatment protocol called I-RECOVER. Since the protocol is continuously updated as
more data become available, your best bet is to download the latest version straight
from the FLCCC website at covid19criticalcare.com.
For additional suggestions, check out the World Council for Health’s spike protein detox
guide, which focuses on natural substances like herbs, supplements and teas. Sauna
therapy can also help eliminate toxic and misfolded proteins by stimulating autophagy.
Sources and References
International Journal of Vaccine Theory, Practice and Research May 10, 2021; 2(1): 402-444
2ndsmartestguyintheworld.com August 18, 2022
Nature December 6, 2023
Trial Site News December 7, 2023
The Telegraph December 6, 2023
Journal off Theoretical Biology May 2013; 325: 52-61
Twitter/X Dr. David Cartland February 24, 2024
LifeSite News March 4, 2024
Journal of Clinical Medicine 2024; 13(5): 1208
Vaccine February 12, 2024 [epub ahead of print]
5.3.6 Cumulative Analysis of Post-Authorization Adverse Event Reports Received Through 28-Feb-2021,
Pages 30-38
RW Malone MD Substack March 6, 2024
Journal of Evaluation in Clinical Practice March 26, 2023; 30(1): 30-36
Journal of Evaluation in Clinical Practice July 4, 2023; 30(1): 82-85
Journal of Evaluation in Clinical Practice July 15, 2023; 30(1): 105-106
Journal of Evaluation in Clinical Practice January 18, 2024
Covid19criticalcare.com
World Council for Health Spike Protein Detox Guide November 30, 2021

 

[ktrapper]

Parts of this did not copy exactly right. I apologize. On my phone but thought this needed to be be posted.

https://media.mercola.com/ImageServer/Public/2024/April/PDF/prion-brain-diseases-pdf.pdf

Doctors Predict Epidemic of Prion Brain Diseases
Analysis by Dr. Joseph Mercola April 29, 2024


STORY AT -A-GLANCE
According to mounting data, one of the more serious side effects of the COVID mRNA
jabs appears to be dementia, and worse yet, this previously untransmissible disease
may now be “contagious, ” transmissible by way of prions.
In my 2021 interview with Stephanie Seneff, Ph.D., she explained why she suspected the
COVID shots may eventually result in an avalanche of neurological prion-based diseases
Doctors Predict Epidemic of Prion Brain Diseases
Analysis by Dr. Joseph Mercola April 29, 2024
Mounting research suggests a serious side effect of the COVID mRNA jabs could be
dementia, and the prions that cause it may be contagious

Frameshifting, as we now know occurs in the COVID shots, can induce prion production
and lead to neurodegenerative diseases such as Alzheimer’s and Creutzfeldt-Jakob
disease (CJD)

Sid Belzberg's prions.rip website, which collected data on neurological side effects post-
jab, found a notably high incidence of diagnosed CJD cases, suggesting an alarming
trend

A series of articles highlight biases in clinical trials and observational studies, suggesting
COVID-19 vaccines' safety and effectiveness have been massively overstated

The Global COVID Vaccine Safety Project study — funded by the U.S. Centers for Disease
Control and Prevention — reveals significant side effects, including myocarditis,
pericarditis, and blood clots, underscoring the need for reevaluation of COVID vaccine
risks and benefits

such as Alzheimer’s. She also published a paper detailing those mechanisms in the May
10, 2021, issue of the International Journal of Vaccine Theory. As she explained in that
paper:
“A paper published by J. Bart Classen (2021) proposed that the spike protein in
the mRNA vaccines could cause prion-like diseases, in part through its ability to
bind to many known proteins and induce their misfolding into potential prions.
Idrees and Kumar (2021) have proposed that the spike protein’s S1 component
is prone to act as a functional amyloid and form toxic aggregates ... and can
ultimately lead to neurodegeneration. ”
In summary, the take-home from Seneff’s paper is that the COVID shots, offered to
hundreds of millions of people, are instruction sets for your body to make a toxic protein
that will eventually wind up concentrated in your spleen, from where prion-like protein
instructions will be sent out, leading to neurodegenerative diseases.
What Are Prions?
The term "prion" derives from "proteinaceous infectious particle. " Prions are known to
cause a variety of neurodegenerative diseases in animals and humans, such as
Creutzfeldt-Jakob disease (CJD) in humans, bovine spongiform encephalopathy (BSE or
"mad cow disease") in cattle, and chronic wasting disease in deer and elk.
These diseases are collectively referred to as transmissible spongiform
encephalopathies (TSEs). They’re characterized by long incubation periods, brain
damage, the formation of holes in the brain giving it a sponge-like appearance, and
failure to induce an inflammatory response.
“Infectious prions propagate by transmitting their
misfolded protein state to normal variants of the same
protein.”
1
In short, prions are infectious agents composed entirely of a protein material that can
fold in multiple, structurally distinct ways, at least one of which is transmissible to other
prion proteins, leading to a disease that is similar to viral infections but without nucleic
acids.
Unlike bacteria, viruses, and fungi, which contain nucleic acids (DNA or RNA) that
instruct their replication, prions propagate by transmitting their misfolded protein state
to normal variants of the same protein.
According to the prion disease model, the infectious properties of prions are due to the
ability of the abnormal protein to convert the normal version of the protein into the
misfolded form, thereby setting off a chain reaction that progressively damages the
nervous system.
Prions are remarkably resistant to conventional methods of sterilization and can survive
extreme conditions that would normally destroy nucleic acids or other pathogens, which
is part of why prion diseases are so difficult to treat.
More Evidence mRNA Shots Can Trigger Dementia
Today, there’s even more evidence to support Seneff’s theory. In August 2022, tech
entrepreneur Sid Belzberg wrote about prions.rip, a website he’d set up to collect data
on the neurological side effects of the jabs. (This site is no longer live.)
Within a few months, the site had received about 15,000 hits and gathered 60 reports
from people who got the jab and suffered neurological deficits shortly thereafter,
including six cases of diagnosed CJD.
“Normally this disease affects 1 in a 1,000,000 people, ” Belzberg wrote. “To get
6 cases you would need 6,000,000 hits to the site assuming everyone reports.
The chances of getting 1 case in 15,000 hits is 1 in 66. To see 6 cases in 1
group of 15,000 is 1/66^6 or 1 in 82,000,000,000, or 20 times more likely to win
a Powerball lottery! ...
2
3
To reiterate, CJD is an exceptionally rare disease that is now a known and
established severe adverse reaction (SAE) from the DEATHVAX™. Injecting this
slow kill bioweapon can cause ailments that are about as likely to develop in the
real word as getting struck by lightning twice. The proof is now irrefutable. ”
Frameshifting Can Result in Prion Production
In mid-December 2023, researchers reported that the replacing of uracil with
synthetic methylpseudouridine in the COVID shots — a process known as codon
optimization — can cause frameshifting, a glitch in the decoding, thereby triggering the
production of off-target aberrant proteins.
The antibodies that develop as a result may, in turn, trigger off-target immune reactions.
According to the authors, off-target cellular immune responses occur in 25% to 30% of
people who have received the COVID shot. But that’s not all.
According to British neuroscientist Dr. Kevin McCairn, this frameshifting phenomenon
has also been linked to harmful prion production — and that frame shifted prions,
specifically, are infectious and can be transmitted from one person to another. As
reported in the Journal of Theoretical Biology in 2013:
“A quantitatively consistent explanation for the titres of infectivity found in a
variety of prion-containing preparations is provided on the basis that the
etiological agents of transmissible spongiform encephalopathy comprise a very
small population fraction of prion protein (PrP) variants, which contain
frameshifted elements in their N-terminal octapeptide-repeat regions ...
Frameshifting accounts quantitatively for the etiology of prion disease. One per
million frameshifted prions may be enough to cause disease. The HIV TAR-like
element in the PRNP mRNA is likely an effector of frameshifting. ”
McCairn explained this mechanism in a February 19, 2023, interview with Health
Alliance Australia (video above). In it, he noted:
4,5,6
7
“Mis-folded proteins caused by prions can impact every level organ and tissue
system in the body ... [They] bioaccumulate and are resistant to degradation,
thereby building up ... ”
Prions may in fact be the primary molecule that is being “shed” by COVID jab recipients,
and if those prions are due to frameshifting, that could be very bad news indeed,
considering their implication in dementia.
Another doctor who believes we’ll be facing an “epidemic of prion disease” is Dr. David
Cartland. In late February 2024, he posted 13 scientific papers linking the COVID jabs,
prion diseases and CJD, noting that was just a “small selection” of what’s available in the
medical literature.
Prions Implicated in Long COVID as Well
According to genomics expert Kevin McKernan, Ph.D., prions are also involved in long
COVID (or as McKernan calls it, “long vax”). In one 2024 study, 96.7% of long COVID
sufferers had received the jab. In an interview with the Front Line COVID-19 Critical Care
Alliance (FLCCC), McKernan stated:
“If you frameshift over the stop codons, you’re going to be making proteins that
are spike-mito proteins. When I talk to a lot of the long vax patients I hear of all
these things that remind me of my time in the mitochondrial disease
sequencing space ... ”
McKernan claims he tried to publish a paper on this in 2021 with Dr. Peter McCullough,
but the editor of the journal “stepped in and torpedoed the paper.
”
World’s Largest Side Effect Analysis Has Been Published
In related news, the largest study to date on the side effects of the COVID jabs was
published in the journal Vaccine in February 12, 2024, and it confirms what I and many
8
9 10
11
12
13
other alternative news sources have been saying all along, namely that the mRNA jabs
are the most dangerous medical products to ever hit the market.
The study — performed by the Global COVID Vaccine Safety (GCoVS) Project and funded
by the U.S. Centers for Disease Control and Prevention, Public Health Ontario and the
Canadian Health Research Institute — evaluated the risk of "adverse events of special
interest" (AESI) following COVID-19 “vaccination. ”
Data from 10 sites in eight countries (Argentina, Australia, Canada, Denmark, Finland,
France, New Zealand and Scotland) were included, encompassing more than 99 million
jabbed individuals.
Of the thousands of side effects Pfizer listed in its confidential report of post-
authorization adverse events submitted to the U.S. Food and Drug Administration, the
GCoVS focused on 13 AESIs that fall into three primary categories: Neurological,
hematologic (blood-related) and cardiovascular conditions.
They calculated the AESI risk for each of the 13 AESIs based on the number of observed
versus expected (OE) incidents occurring up to 42 days after injection. The “expected”
number of side effects were based on vaccine adverse event data from 2015 to 2019.
These rates were then compared to the adverse event rates observed in those who got
one or more of the COVID jabs, either Pfizer's BNT162b2, Moderna's mRNA-1273, or
AstraZeneca's ChAdOx1.
Largest Study to Date Confirms COVID Jab Dangers
The analysis revealed several concerning side effects, including increased risks of
myocarditis, pericarditis, blood clots in the brain, and various neurological conditions.
Here’s a quick summary of the findings:
• Myocarditis and pericarditis:
◦ Pfizer vaccine — OE ratios for myocarditis were 2.78 and 2.86 after the first
and second shots, with the risk remaining doubled after the third and fourth
14
15
shots.
◦ Moderna vaccine — OE ratios for myocarditis were 3.48 and 6.10 after the first
and second shots. Doses 1 and 4 also showed OE ratios of 1.74 and 2.64 for
pericarditis.
◦ AstraZeneca vaccine — OE ratio for pericarditis was 6.91 after the third shot.
• Blood clots in the brain (cerebral venous sinus thrombosis, CVST):
◦ An OE of 3.23 for CVST was observed after the first AstraZeneca shot.
◦ A significant increase in CVST risk was also noted after the second Pfizer dose.
• Neurological conditions:
◦ Guillain-Barré syndrome — An OE ratio of 2.49 was observed following the
AstraZeneca jab.
◦ Transverse myelitis — Risk nearly doubled with the AstraZeneca shot.
◦ Acute disseminated encephalomyelitis — OE ratios of 3.78 (Moderna) and 2.23
(AstraZeneca) were noted.
These findings really underscore the potential for serious side effects from the COVID
shots, including conditions that may lead to other consequences in the longer term,
such as stroke, heart attack, paralysis and death.
Effectiveness and Safety Was Wildly Exaggerated in Trials
Considering those findings, it’s no surprise to find that effectiveness and safety were
exaggerated in clinical trials and observational studies. In a guest post on Dr. Robert
Malone’s Substack, Raphael Lataster, Ph.D., writes:
“An unofficial series of four crucially important medical journal articles, two by
me, appearing in major academic publisher Wiley’s Journal of Evaluation in
Clinical Practice reveals that claims made about COVID-19 vaccines’
16
effectiveness and safety were exaggerated in the clinical trials and
observational studies, which significantly impacts risk-benefit analyses.
Also discussed are the concerning topics of myocarditis, with evidence
indicating that this one adverse effect alone means that the risks outweigh the
benefits in the young and healthy; and perceived negative effectiveness, which
indicates that the vaccines increase the chance of COVID-19
infection/hospitalization/death, to say nothing about other adverse effects. ”
Summary of Papers
The four papers in question include:
1. “Sources of Bias in Observational Studies of COVID-19 Vaccine Effectiveness”
published in the Journal of Evaluation in Clinical Practice in March 2023, co-
authored by BMJ editor Peter Doshi, Ph.D., statistician Kaiser Fung and
biostatistician Mark Jones, which concluded that “case-counting window bias” had
a significant effect on effectiveness estimates.
As explained by Lataster, this “concerns the 7 days, 14 days, or even 21 days after
the jab where we are meant to overlook jab-related issues, such as COVID
infections, for some odd reason as ‘the vaccine has not had sufficient time to
stimulate the immune system. ’
This may strike you as quite bizarre since all of the ‘fully vaccinated’ must go
through the process of being ‘partially vaccinated, ’ sometimes even more than once.
To make matters worse, the unvaccinated do not get such a ‘grace period, ’ meaning
that there is also a clear bias at play.
In an example using data from Pfizer’s clinical trial, the authors show that thanks to
this bias, a vaccine with effectiveness of 0%, which is confirmed in the hypothetical
clinical trial, could be seen in observational studies as having effectiveness of 48%. ”
17
2. “Reply to Fung et. al. on COVID-19 Vaccine Case-Counting Window Biases
Overstating Vaccine Effectiveness, ” authored by Lataster, which discussed how the
counting window bias not only affected effectiveness estimates in observational
studies but also safety estimates, suggesting a need for reassessment of vaccine
safety. The article also addresses “the mysterious rise in non-COVID excess
deaths post-pandemic. ”
3. “How the Case Counting Window Affected Vaccine Efficacy Calculations in
Randomized Trials of COVID-19 Vaccines, ” again co-authored by Doshi and Fung,
which detailed how case-counting window issues also overestimated effectiveness
in Pfizer and Moderna clinical trials.
4. A second article by Lataster, in which he highlighted and summarized the evidence
showing that clinical trials were affected by adverse effect counting window issues
that led to exaggerated safety estimates.
“Together, these four articles make clear that claims made about COVID-19 vaccines;
effectiveness and safety were exaggerated in the clinical trials and observational
studies, whilst also finding time to discuss myocarditis and perceived negative
effectiveness, meaning that new analyses are very much needed, ” Lataster writes.
Resources for Those Injured by the COVID Jab
Based on data from across the world, it’s beyond clear that the COVID shots are the
most dangerous drugs ever deployed. If you already got one or more COVID jabs and are
now reconsidering, you’d be wise to avoid all vaccines from here on, as you need to end
the assault on your body. Even if you haven’t experienced any obvious side effects, your
health may still be impacted long-term, so don’t take any more shots.
If you’re suffering from side effects, your first order of business is to eliminate the spike
protein — and/or any aberrant off-target protein — that your body is producing. Two
remedies shown to bind to and facilitate the removal of SARS-CoV-2 spike protein are
hydroxychloroquine and ivermectin. I don’t know if these drugs will work on off-target
proteins and nanolipid accumulation as well, but it probably wouldn’t hurt to try.
18
19
20
21
22
The Front Line COVID-19 Critical Care Alliance (FLCCC) has developed a post-vaccine
treatment protocol called I-RECOVER. Since the protocol is continuously updated as
more data become available, your best bet is to download the latest version straight
from the FLCCC website at covid19criticalcare.com.
For additional suggestions, check out the World Council for Health’s spike protein detox
guide, which focuses on natural substances like herbs, supplements and teas. Sauna
therapy can also help eliminate toxic and misfolded proteins by stimulating autophagy.
Sources and References
International Journal of Vaccine Theory, Practice and Research May 10, 2021; 2(1): 402-444
2ndsmartestguyintheworld.com August 18, 2022
Nature December 6, 2023
Trial Site News December 7, 2023
The Telegraph December 6, 2023
Journal off Theoretical Biology May 2013; 325: 52-61
Twitter/X Dr. David Cartland February 24, 2024
LifeSite News March 4, 2024
Journal of Clinical Medicine 2024; 13(5): 1208
Vaccine February 12, 2024 [epub ahead of print]
5.3.6 Cumulative Analysis of Post-Authorization Adverse Event Reports Received Through 28-Feb-2021,
Pages 30-38
RW Malone MD Substack March 6, 2024
Journal of Evaluation in Clinical Practice March 26, 2023; 30(1): 30-36
Journal of Evaluation in Clinical Practice July 4, 2023; 30(1): 82-85
Journal of Evaluation in Clinical Practice July 15, 2023; 30(1): 105-106
Journal of Evaluation in Clinical Practice January 18, 2024
Covid19criticalcare.com
World Council for Health Spike Protein Detox Guide November 30, 2021

 

[ktrapper]

I apologize. I had a bit of time trying to copy and paste my above post from my phone but thought it pertinent information to put here. Its from a PDF and my email.

We crap it looks I posted it twice. I hate trying to use phones.
Crappy cell signal doesn't help much either.

 

[naegling62]

Dr. Yeadon really needs a remote starter for his vehicle.

 

[TheSearcher]

Yeah, just what we need... increased surveillance.

These... people... need to conjugate themselves most energetically.

 

[Tristan]

Yeah, just what we need... increased surveillance.

No matter the 'Crisis', the 'Solution' almost always fits into the larger 'plan', doesn't it?

Surveillance, Enforcement, Compliance

As an aside, the interview with Naomi Wolf on main was excellent. It ties together many different points into a relatively cohesive whole. She has certainly evolved in her thinking the past several years.

 

[Tristan]

These... people... need to conjugate themselves most energetically.

Unfortunately, 'These... people...' give not a single sh*t what our suggestions are.

 

[Heliobas Disciple]

China is gunning for the chief scientist of its COVID vaccine project, accusing him of 'serious discipline and law violations'

Yang Xiaoming was kicked from the National People's Congress earlier this month. He was in charge of the team that created the Sinopharm vaccine.

news.yahoo.com

(fair use applies)


China is gunning for the chief scientist of its COVID vaccine project, accusing him of 'serious discipline and law violations'
Matthew Loh - Business Insider
Mon, April 29, 2024, 2:10 AM EDT

• The chief scientist of China's COVID vaccine project was kicked from the National People's Congress.
• Yang Xiaoming, 62, is accused of "serious discipline and law violations," a phrase alluding to corruption.
• Yang led the team that developed the Sinopharm vaccine, and was China's top researcher in its vaccine project.

The chief researcher of China's first general-use COVID vaccine was ousted last week from the country's highest organ of power.

Yang Xiaoming, 62, was booted on April 23 from the National People's Congress "due to serious discipline and law violations," state media reported this weekend.

The phrase typically means a person is under investigation for corruption in China.

That means Yang, the chairman of Sinopharm's vaccine subsidiary China National Biotec Group, is no longer one of the nearly 3,000 congressional deputies who make decisions on major national issues.

A congressional report on his dismissal said he served on the Ethnic Affairs Committee.

Yang is a medical researcher who led the Sinopharm team that developed the BBIBP-CorV vaccine, a COVID-19 shot that was the nation's first approved for general use.

Known colloquially as the Sinopharm vaccine, the shot was one of the most widely administered COVID-19 shots in China, with an efficacy of 79% against hospitalization.

Apart from developing the Sinopharm shot, Yang was also the head of China's vaccine project under the 863 program, or Beijing's push to make the country more independent by developing homegrown advanced technologies.

Yang's dismissal has gone viral on Weibo, China's version of X, with thousands of posts questioning the circumstances behind his removal from deputy status. It received around 180 million views and, for several hours, was the platform's hottest topic on Sunday.

The discussion soon morphed into wild speculation that the reason behind his dismissal may have been related to the Sinopharm vaccine, though there has been no evidence to indicate as such.

"The father of the Sinopharm vaccine violated regulations and laws, but it doesn't mean there are problems with the vaccines he developed and produced," wrote "Dr Chen," a popular medical blogger. "Let's wait before panicking."

The announcement about Yang comes amid China's sweeping crackdown on corruption in its healthcare sector, with investigations launched against hundreds of hospital deans and secretaries.

It's been the heaviest disciplinary campaign ever enforced on China's healthcare industry, plagued for years by thousands of commercial bribery cases between pharmaceutical suppliers and healthcare providers.

In August, the anti-corruption campaign caused pharmaceutical A-share stocks in China to fall so sharply that it wiped out an estimated $27 billion market value within one day.

I don't think this is the same scientist as the one in the quoted article, but if it's not, looks like China is cleaning house (????)

Chinese scientist who first published COVID sequence protests after being locked out of his lab

The first scientist to publish a sequence of the COVID-19 virus in China was staging a sit-in protest after authorities locked him out of his lab.

apnews.com

(fair use applies)


Chinese scientist who published first sequence of COVID virus protests after being evicted from lab
April 29, 2024

SHANGHAI (AP) — The first scientist to publish a sequence of the COVID-19 virus in China was staging a sit-in protest after authorities locked him out of his lab.

Virologist Zhang Yongzhen wrote in an online post on Monday that he and his team were suddenly notified they were being evicted from their lab, the latest in a series of setbacks, demotions and ousters since he first published the sequence in early January 2020.

The move shows how the Chinese government continues to pressure and control scientists, seeking to avoid scrutiny of its handling of the coronavirus outbreak.

Zhang wrote the post on Chinese social media platform Weibo but it was later deleted.

In protest, Zhang had been sitting outside his lab since Sunday despite pouring rain, he said in the post. Zhang, when reached by phone on Tuesday, said it was “inconvenient” for him to speak, but a collaborator confirmed to AP on Monday the protest was taking place.

 

[Heliobas Disciple]

I recently posted about the new variant KP.2 but I hadn't really heard about it in the MSM. Now it's making MSM news too. I will repost the two articles I posted about KP.2 in the next post.

What to Know About the 'FLiRT' Variants of COVID-19

Preliminary studies suggest they may be better at dodging immune protection from vaccines.

news.yahoo.com

(fair use applies)


What to Know About the 'FLiRT' Variants of COVID-19
Jamie Ducharme - TIME
Mon, April 29, 2024, 2:46 PM EDT

The COVID-19 lull in the U.S. may soon come to an end, as a new family of SARS-CoV-2 variants—nicknamed “FLiRT” variants—begins to spread nationwide.

These variants are distant Omicron relatives that spun out from JN.1, the variant behind the surge in cases this past winter. They’ve been dubbed “FLiRT” variants based on the technical names for their mutations, one of which includes the letters “F” and “L,” and another of which includes the letters “R” and “T.”

Within the FLiRT family, one variant in particular has risen to prominence: KP.2, which accounted for about 25% of new sequenced cases during the two weeks ending Apr. 27, according to data from the U.S. Centers for Disease Control and Prevention (CDC). Other FLiRT variants, including KP.1.1, have not become as widespread in the U.S. yet.

Researchers are still learning about the FLiRT variants, and many questions remain about how quickly they’ll spread, whether they’ll cause disease that’s more or less severe than what we’ve seen previously, and how well vaccines will stand up to them. Here’s what we know so far.


Is another COVID-19 wave coming?

Despite KP.2's rise in the U.S., it’s too soon to tell whether the FLiRT family will be responsible for a major surge in cases, says Dr. Eric Topol, executive vice president at Scripps Research, who wrote about the FLiRT variants in a recent edition of his newsletter. For now, the amount of SARS-CoV-2 virus in U.S. wastewater remains “minimal,” according to the CDC, and hospitalizations and deaths have also continued to decline steadily since their recent peaks in January. At the global level, case counts rose from early to mid-April, but remain far lower than they were a few months ago.

KP.2 and its relatives will likely cause an uptick in cases, but “my hunch is it won’t be a big wave,” Topol says. “It might be a ‘wavelet.’” That’s because people who were recently infected by the JN.1 variant seem to have some protection against reinfection, Topol says, and the virus hasn’t mutated enough to become wildly different from previous strains. A recent study from researchers in Japan, which was posted online before being peer-reviewed, also found that KP.2 is less infectious than JN.1.


Do vaccines protect against KP.2 and other FLiRT variants?

Vaccines still provide good protection against COVID-19-related hospitalization and death. But two preliminary studies—the one from Japan and another from researchers in China, which was also posted online before being peer-reviewed—suggest the FLiRT variants may be better at dodging immune protection from vaccines than JN.1 was.

“That isn’t good,” Topol says, especially since many people who got the most recent booster—roughly 30% of adults in the U.S.— got it last fall, meaning their protection has begun to wane.

In an Apr. 26 statement, the World Health Organization recommended basing future vaccine formulations on the JN.1 lineage, since it seems the virus will continue to evolve from that variant. The most recent booster was based on an older strain, XBB.1.5.


How can I stay safe from new COVID-19 variants?

The virus continues to evolve, but public-health advice remains the same: stay up-to-date on vaccines, test before gatherings, stay home when you're ill, and consider masking and avoiding crowded indoor areas, especially when lots of COVID-19 is going around.

 

[Heliobas Disciple]

The two articles I recently posted about KP.2.

One from Geert, one from Nik at Thailand Medical News.

Is the spike protein of KP.2 adorned with additional glycan chains?

Recently, it has been described how the SARS-CoV-2 (SC-2) KP.2 variant (JN.1.11.1.2) is capable of rapidly gaining ground on the hitherto predominant 'parent' variant, namely JN.1 (itself descending from BA.2.86; https://www.biorxiv.org/content/10.1101/2024.04.24.590786v1

voiceforscienceandsolidarity.substack.com

(fair use applies)

Is the spike protein of KP.2 adorned with additional glycan chains?
Geert Vanden Bossche
Apr 28, 2024

Recently, it has been described how the SARS-CoV-2 (SC-2) KP.2 variant (JN.1.11.1.2) is capable of rapidly gaining ground on the hitherto predominant 'parent' variant, namely JN.1 (itself descending from BA.2.86; | bioRxiv fig. 1). This evolution sharply contrasts with the trend observed so far, namely that the fitness advantage of new JN.1 descendants is not strong enough to sufficiently displace JN.1, thus causing different, more transmissible JN.1 variants to consecutively emerge (How things could change... ("Het kan verkeren"…) | Voice for Science and Solidarity).

According to the concept illustrated in fig. 2 below, which depicts the shift from virus internalization into antigen-presenting cells (APCs) to virus adsorption onto APCs, heightened virus adsorption onto migratory dendritic cells (DCs), coupled with KP.2's enhanced resistance to binding by vaccine-primed potentially neutralizing antibodies (pNAbs), diminishes cytotoxic T lymphocyte (CTL) activation and thus reignites virus spread. This would enable SC-2 variants showing an increased degree of glycosylation to promote their transmission. This is because increased glycosylation of viral surface proteins, for example, the spike (S) protein, can enhance binding of glycosylated viruses to lectins[1] expressed on the surface of DCs. The reinforced interaction of the virus with lectins expressed on DCs will only increase the adsorption of progeny virions and thus the immune pressure on the non-neutralizing polyreactive antibodies (PNNAbs) [https://www.voiceforscienceandsolid...og/i-can-now-spot-the-tsunami-at-the-horizon; JN.1 quasispecies | Voice for Science and Solidarity].

Despite the fact that additional virus glycosylation likely hampers intrinsic viral infectiousness, it is still possible that increased viral transmission will ultimately result in increased viral fitness of KP.2 relative to JN.1. This indeed seems plausible, as additional glycosylation is likely to further reduce viral susceptibility to binding by pNAbs. Furthermore, because of their increased adsorption on DCs, the intrinsic infectiousness of JN.1 progeny virions is constrained as well.

The above-described dynamics of virus evolution and spread could explain the appearance and increasing spread of KP.2: “The escalating variant frequency of KP.2 underscores the variant’s ability to outcompete existing lineages and establish itself as a significant contributor to the ongoing pandemic dynamics” (https://www.thailandmedical.news/ne...ariants-behind-spring-s-silent-covid-19-surge).

As far as I am aware, the glycosylation profile of KP.2 has not yet been reported. However, it is evident that despite its significantly reduced intrinsic infectiousness (i.e., compared to JN.1), KP.2 exhibits a clear competitive advantage in terms of its spread. Nonetheless, I believe that the fitness advantage of KP.2 will ultimately prove insufficient to ensure the virus's continued dissemination. Therefore, I feel very concerned that the KP.2 variant will soon be replaced by a new coronavirus (CoV) lineage, in which the S protein's glycosylation will fully overcome the virulence-inhibiting effect of PNNAbs. Only then will the virus regain an effective growth advantage. However, this dramatic increase in viral replication will primarily occur within infected hosts rather than through inter-host transmission.

In conclusion, it is crucial to investigate KP.2's glycosylation profile to better understand its unique virological behavior and determine whether KP.2 could herald the emergence of a new CoV lineage with enhanced virulence potential for COVID-19 vaccine recipients. Regardless of the underlying structural changes in the S protein, it seems likely that KP.2’s ability to establish itself as a significant contributor to the JN.1 quasispecies population suggests the virus's readiness to undergo a dramatic structural and functional transformation (JN.1 quasispecies | Voice for Science and Solidarity). This readiness could precipitate the sudden emergence of a new CoV lineage, namely HIVICRON, capable of inducing a significant surge in enhanced severe disease across highly COVID -19 vaccinated populations.

[1] Lectins are proteins that can bind specifically to certain carbohydrate structures present on the surface of pathogens, such as viruses.

Fig. 1:

Fig. 2:

Early Omicron descendants enter target host cells via PNNAb-dependent enhancement of infection (?). PNNAbs bind to progeny virus tethered to these DCs, which subsequently migrate to the lungs and other distal organs (). On the other hand, previously SIR-primed Abs bind with low-affinity to the antigenically more distant immune escape variant, thereby generating Ab-virus complexes that are taken up into patrolling APCs (?). Enhanced uptake of large Ab-virus complexes into APCs facilitates strong activation of CTLs, thereby enabling the elimination of virus-infected host cells.

Highly infectious Omicron descendants do not rely on PNNAb-dependent enhancement of infection to enter target host cells. Replication of highly infectious variants generates an immunological environment that promotes their adsorption onto tissue-resident DCs. Due to their high level of intrinsic infectiousness, newly emerging, more transmissible Omicron descendants (e.g., members of the JN.1 clan) will therefore enhance the adsorption of progeny virions on migratory DCs and thereby reduce viral uptake by APCs. Reduced viral uptake by APCs will promote the priming of CD4+ T cells. Some of these T cells may be self-reactive, while others are foreign-centered but fail to serve as T helper cells to assist in boosting of previously SIR-primed Abs due to a lack of immune recognition of the corresponding S-associated B cell epitopes comprised within large Ab-coated virus complexes. Diminished boosting of previously primed anti-S Abs results in diminished production of PNNAbs.

As these more infectious and inflammatory variants (i.e., the JN.1 clan) steadily increase in prevalence, diminished production of PNNAbs, combined with their enhanced binding to highly infectious DC-tethered progeny virions leads to a steadily increasing immune pressure on viral virulence in highly Covid-19 (C-19) vaccinated populations. This is thought to eventually trigger the selection of a new Coronavirus lineage that has the capacity to cause PNNAb-mediated enhancement of vaccine breakthrough infections in highly C-19-vaccinated populations, thereby causing a massive wave of enhanced severe C-19 disease.

https://www.thailandmedical.news/news/study-identifies-virological-characteristics-of-the-sars-cov-2-kp-2-variant-one-of-the-variants-behind-spring-s-silent-covid-19-surge

(fair use applies)

Study Identifies Virological Characteristics Of The SARS-CoV-2 KP.2 Variant, One Of The Variants Behind Spring’s Silent COVID-19 Surge
Nikhil Prasad Fact checked by:Thailand Medical News Team
Apr 27, 2024

Many are unaware that there is currently a silent rise in COVID-19 infections occurring in parts of United Kingdom, Netherlands, Germany, France, United States, India, China, Japan, Australia, Russia, Iran and New Zealand.

Government authorities are simply downplaying or concealing the statistical COVID-19 data and mainstream media have been bought to refrain from writing too much about these rising infections. Even by reducing testing and changing to waste-waste monitoring companies that are more compliant to government policies, many independent sources are still clearly indicating a rise of infections.

Unfortunately, even search engines are now shadow-banning or lowering the news feed exposure of any COVID-19 News coverages that report about rising COVID-19 cases in any geolocations.

What is worrying however is that the rise of the new COVID-19 waves are being driven by a totally new line of SARS-CoV-2 JN.1 spawns including the KP variant with its lineages like KP.1, KP.1.1, KP.1.1.1, KP.2, KP.2.2 KP.3, KQ.1, KS.1 and KR.1.

Most of these new variants are also known at the FLiRT variants and spot the mutations F456L and R346T which give them an effective growth advantage over other circulating variants and are more immune evasive and transmissible.

The KP variants in particular are behind the new COVID-19 surges that are underway and are expected to play a key role in this Spring’s surges.

The ongoing evolution of the SARS-CoV-2 virus has led to the emergence of various variants, each with unique characteristics influencing its transmissibility, virulence, and immune evasion. Among these variants, the KP.2 variant, a descendant of the JN.1 lineage, has garnered attention for its rapid spread and potential impact on public health.

A new study by researchers from the University of Tokyo-Japan, Kobe University-Japan, Keio University School of Medicine-Japan, Tokyo Medical and Dental University-Japan, Tokyo Metropolitan Institute of Public Health-Japan, Kumamoto University-Japan and MRC-University of Glasgow Centre for Virus Research-UK delves into the virological features of the SARS-CoV-2 KP.2 variant, shedding light on its genetic makeup, fitness advantages, and immune evasion strategies.


Evolutionary Trajectory of the JN.1 Variant
The JN.1 variant, originating from the BA.2.86(.1) lineage with the S:L455S substitution, demonstrated increased fitness and successfully outcompeted the previously dominant XBB lineage by early 2024. This evolutionary success led to the diversification of the JN.1 lineage, giving rise to progenies with key spike protein substitutions such as S:R346T and S:F456L. Notably, one of these progenies, the KP.2 variant (JN.1.11.1.2), emerged as a rapidly spreading variant in multiple regions by April 2024.


Genetic Composit ion of the KP.2 Variant
The KP.2 variant carries three notable substitutions in the Spike (S) protein, including S:R346T and S:F456L, along with an additional substitution in non-S protein regions compared to its precursor JN.1. These genetic alterations are crucial in understanding the variant's biological behavior and potential impact on transmission dynamics.


Enhanced Fitness and Epidemiological Impact
Through Bayesian multinomial logistic modeling based on genome surveillance data from the USA, United Kingdom, and Canada, the relative effective reproduction number (Re) of KP.2 was estimated. The analysis revealed that KP.2 exhibits 1.22-, 1.32-, and 1.26-fold higher Re values compared to JN.1 in the respective countries. These findings indicate a higher viral fitness for KP.2, suggesting its potential to become the predominant lineage globally.


Spread and Frequency Dynamics
By the beginning of April 2024, the estimated variant frequency of KP.2 had already reached 20% in the United Kingdom, indicating its rapid dissemination within a short timeframe. This escalating frequency underscores the variant's ability to outcompete existing lineages and establish itself as a significant contributor to the ongoing pandemic dynamics.


Infectivity and Immune Resistance
In terms of infectivity, KP.2 demonstrated a significant 10.5-fold decrease in infectivity compared to JN.1, as observed in pseudovirus assays. Furthermore, neutralization assays using sera from monovalent XBB.1.5 vaccinees and individuals with breakthrough infections highlighted KP.2's heightened resistance to neutralization. The 50% neutralization titer (NT50) against KP.2 was notably lower than that against JN.1 across all tested scenarios, indicating a reduced susceptibility to vaccine-induced and infection-acquired immunity.


Implications for Public Health and Vaccination Strategies
The findings regarding KP.2's increased immune resistance and higher Re values have critical implications for public health interventions and vaccination strategies. The variant's ability to evade neutralizing antibodies to a greater extent than previous variants, including JN.1, necessitates ongoing surveillance, rapid variant characterization, and potential adjustments to vaccine formulations or booster strategies to maintain efficacy against evolving strains.


Conclusion
In conclusion, the SARS-CoV-2 KP.2 variant exhibits distinct virological characteristics, including enhanced fitness, rapid spread, reduced infectivity, and increased immune resistance. Understanding these features is paramount in effectively managing and responding to the ongoing COVID-19 pandemic. Continued genomic surveillance, coupled with proactive public health measures and adaptive vaccination campaigns, remains essential in mitigating the impact of emerging variants like KP.2 and ensuring optimal control of viral transmission.

The study findings were published on a preprint server and are currently being peer reviewed.

Virological characteristics of the SARS-CoV-2 KP.2 variant

The JN.1 variant (BA.2.86.1.1), arising from BA.2.86(.1) with the S:L455S substitution, exhibited increased fitness and outcompeted the previous dominant XBB lineage by the biggening of 2024. JN.1 subsequently diversified, leading to the emergence of descendants with spike (S) protein...

www.biorxiv.org

Thailand Medical News would like to add that why we think that these KP variants are more worrisome is because not only are they more immune evasive but they are believed to be better at disarming all the initial host immune responses and are suited for viral persistence. However, as they are also good at disarming the specific immune response in various reservoir segments across the body, they can silently cause enough cell, tissue and critical cellular pathway damage in these areas before actual symptoms manifest signifying a serious problem. We can expect to see a higher incidence of various organ failures and sepsis from these variants along with other serious medical issues.

 

[Heliobas Disciple]

What we’re starting to learn about H5N1 in cows, and the risk to people

Questions about H5N1 for which there are pretty clear answers when it comes to birds are suddenly unsettled science in cows.

www.statnews.com

(fair use applies)


What we’re starting to learn about H5N1 in cows, and the risk to people
By Helen Branswell and Megan Molteni
April 30, 2024

The H5N1 bird flu virus has been around for decades, and the damage it wreaks on chickens and other poultry is well documented. But the recent discovery that the virus has jumped into dairy cattle — whose udders seem to be where the virus either infects or migrates to — has dumbfounded scientists and agricultural authorities.

Questions for which there are pretty clear answers when it comes to birds are suddenly unsettled science in cows. How are they getting infected? Are they transmitting the virus cow to cow, or are human actions — activities that are part of the day-to-day of farming — serving as an unrecognized amplifier of viral transmission? In the interface between infected cows and humans, how might people be at risk? Does consuming milk laced with live H5 virus pose a hazard?

At this point in the H5N1-in-cows story, these are questions that don’t have solid answers, though some evidence is coming into focus. Getting answers is critical, for controlling spread among cows, if that’s still possible; stopping transmission from cows to key species like poultry or pigs; and keeping the virus from getting a foothold in the human population.

Let’s explore the little we know, and the much more we don’t know.


Are cows spreading the virus the way people transmit flu?

Wash your hands; cover your cough; wear a mask. These are things public health officials advise at the start of each flu season. That’s because the influenza viruses that typically infect humans spread primarily through the air — either through small, virus-laced particles that can be inhaled, or through larger droplets that spray out of a sick person’s mouth when they cough or sneeze.

Scientists are now trying to figure out if cows are passing around the H5N1 bird flu in the same way. So far, it seems possible, but unlikely to be the main driver of disease transmission.

The U.S. Department of Agriculture has said few tests from the respiratory tracts of infected cows have come back positive — and those that did showed there wasn’t a lot of virus present. But there is at least some evidence that H5N1 is on occasion getting deep into the respiratory tracts of cows. The USDA said in a frequently asked questions document it released last week that its National Veterinary Services Laboratories had found H5N1 in a lung tissue sample from an asymptomatic dairy cow that originated from an affected herd.


So what is the main driver of infection among cows?

While the contribution of respiratory transmission is still in question, there appears to be little doubt that a lot of spread is happening in milking parlors, where cows are strapped into the milking machines, and that in dairy cows, H5N1 seems to be primarily infecting mammary glands. The amount of virus in the udders of infected cows is off-the-charts high, making it easy to see how one cow’s infection soon becomes a herd’s problem.

“You can imagine that if such a cow is milked in a milking stall, even a few drops of milk remaining on the teat cup which is used to milk will then subsequently contaminate the teat of the next cow,” said Thijs Kuiken, a pathologist in the department of viroscience at Erasmus Medical Center in Rotterdam, the Netherlands. “So you can imagine very easily how, in the course of a few days, the virus could spread very fast among the cows being milked on that farm.”

That fits with other evidence: the fact that infections so far appear to be limited to lactating dairy cows, and that the members of a herd that are the biggest milk producers — which are also the animals that stay on milking machines the longest — are the ones most heavily impacted by the disease. “There’s still a lot that’s unknown, but what we’re seeing right now is not a respiratory disease by and large; it’s a mastitic disease,” said Jared Taylor, a professor of veterinary pathobiology at Oklahoma State University. For now, that’s somewhat reassuring, because it means that increased attention to sterilization and disinfection during milking should make a dent in the virus’s further spread. But he stressed that it’s still early and researchers are just starting to study the extent to which there could be respiratory involvement.

Taylor noted another worry: H5N1, which is notorious for its ability to evolve, is being given a huge opportunity to adapt to bovine hosts. “The concern is if it becomes effective as a respiratory pathogen in cattle, it’s more likely to become effective as a respiratory pathogen in humans,” he said.


When are infected cows most contagious?

Little is known about how a cow’s contagiousness changes over the course of an infection with H5N1. Researchers examining outbreaks among dairy cattle in Kansas and Texas found that on affected farms, incidence of the disease peaked four to six days after the first animals began showing symptoms such as lethargy, fever, reduced feed intake, and an abrupt drop in milk production. The spread tapered off within 10 to 14 days, and most animals were slowly returned to regular milking after they recovered.

But researchers have not yet systematically and repeatedly collected samples from affected animals to understand how much virus they are harboring inside their noses or shedding into milk over the course of their infection.

Those are among the types of studies that are urgently needed, Donald Prater, acting director of the Center for Food Safety and Nutrition at the Food and Drug Administration, said during an online symposium last week organized by the Association of State and Territorial Health Officials (ASTHO). “As these animals become infected, what does that profile look like for viral shedding?”

Such research would help answer the question of how much H5N1 virus a cow needs to come in contact with to get infected — the so-called “infectious dose.” Right now, that remains unknown, Prater said.


Can cows be infected but not show symptoms? Can those cows shed virus in milk or spread virus to other cows?

There’s been so little testing going on — and so little disclosed about the numerators and denominators of that testing — that it’s hard to gauge how big an issue asymptomatic infection is and what role, if any, it is playing in transmission within and among herds.

But the information USDA released about the virus having been found in the lung of an asymptomatic cow is clear proof that not all infected cows have outward signs of illness.

Rosemary Sifford, the agency’s chief veterinary officer, said during the ASTHO symposium that little is known about cow-to-cow spread via the respiratory route, but she gave an example of apparent transmission from presymptomatic animals. (A person with flu can be contagious a day before developing symptoms.)

Sifford noted that cows in a herd without symptoms tested positive after cattle were moved into it from another herd whose remaining animals then went on to develop symptoms. The positive cows in the second herd haven’t developed symptoms, she said. “We are just getting underway with those studies to give us an idea of the opportunity for viremia either ahead of or after clinical signs,” she said. “So we should have more information about that in the coming weeks.”

One such study will be taking place in the high-containment laboratories at Kansas State University’s Center of Excellence for Emerging and Zoonotic Animal Diseases. Director Jürgen Richt said his group already has the necessary approvals and hopes to begin the research in mid-May.

They will be experimentally infecting lactating and non-lactating cows with the version of H5N1 that has been found in cattle herds, both by the oral-nasal route and by directly injecting the virus into udders.
The goal: To see where the virus goes in the cows and how they shed it. Is it just found in milk? Or in feces and urine too?

Some uninfected cows will be housed with the infected animals to see whether they contract the virus, Richt said.

As to whether infected cows that have no symptoms are shedding virus in their milk, the evidence of viral traces in commercially purchased milk brings that question to the forefront. Farmers are supposed to discard milk from infected cows, which reportedly looks odd — yellowish and unusually thick. But PCR testing of commercially sold pasteurized milk has shown a substantial portion of samples were positive for RNA from H5N1, indicating the presence of either viral fragments or dead viruses. (The FDA said last week about one in five samples purchased in a cross-country survey tested positive.) So either some farmers aren’t following the recommendation, or some milk isn’t noticeably altered, or some cows that aren’t known to be sick are shedding the virus in their milk.


What is it about milking parlors that allows transmission to occur?

Milking parlors are typically enclosed buildings outfitted with individual stalls arranged in a ring or in rows where dairy cows are led two to three times each day to drain their udders of milk. In a milking operation, the stimulus to secrete milk comes not from the sight or touch of a calf but is usually provided by a farm worker. That person also cleans the animal’s teats with a damp cloth and then dips them into a disinfectant solution to protect them from infectious bacteria present on a farm. The teats are then attached to the milking unit, also called a claw, which consists of a cluster of four rubber or silicon-based liners that fit snugly around each teat. The milking lasts about six to nine minutes per animal, and then each cow receives another disinfectant treatment before it’s ushered out and another animal is brought in.

The problem is that the milking equipment that comes into contact with the cow’s udders is typically not sanitized between individual animals, said Nigel Cook, a professor in Food Animal Production Medicine at the University of Wisconsin-Madison and long-time dairy cow health researcher. Rather, sanitization steps happen only two or three times a day.

“Contamination of the milking unit with milk residue cross-contaminating to the next cow would be a risk — as it would with any mastitis pathogen,” Cook told STAT via email.

Liners also have to be regularly replaced, as wear and tear and chemical exposure make them lose their elasticity, becoming rough and split. When that happens, the liners are more difficult to disinfect and can act as a reservoir for infection.

Liners, dip cups, washrags, and milkers’ gloved hands are all possible means of spreading the virus from one animal to the next. Washrags used on different animals are often laundered together before repeat use, but some dairies don’t use hot water, and researchers have found genetic traces of H5N1 on both used and clean rags using PCR testing. More work is needed to figure out which vectors are playing the biggest role, scientists told STAT.

Kuiken is a bit pessimistic about whether, once the virus has found its way into a herd, transmission can be stopped: “You can’t not milk. And you probably can’t milk so well as to prevent cow-to-cow spread. I don’t think you can do it.”


What puts people working on dairy farms at highest risk?

Only one human infection — a Texas dairy farm worker who developed conjunctivitis — has been reported, but anecdotal reports abound of other farm workers with conjunctivitis and mild respiratory symptoms. Scientists at the Centers for Disease Control and Prevention are working to figure out where the biggest risks to these workers lie, Sonja Olsen, associate director for preparedness and response in CDC’s influenza division, said during the ASTHO symposium. Is it exposure to cows? Contact with milk? Are there specific activities on farms or in slaughterhouses that put people at elevated risk of contracting H5N1?

The CDC recommends that people working with or around cattle suspected or confirmed to be infected with H5N1 wear gloves, disposable fluid-resistant coveralls, vented safety goggles or a face shield, and an N95 respirator.

Kuiken said the setup of many milking parlors is almost tailor-made to put workers in contact with viruses being shed in milk. That’s because there is typically a well — think of the area under the hoist in the garage where your car gets repaired — where workers are located while cows are being milked.

“So the milk worker is standing in a depressed area, and therefore his eyes are about at knee level — a little bit higher, maybe — with the cow. So very good for being inoculated, for eye infection,” he said.

“They can milk the cow beforehand just a little bit, and the spray of milk will come out of the teat. That’s one way of getting infected. Taking off or putting on the teat cups is one way. The cows are defecating and urinating during the milking process, or afterwards. They clean the [milking parlor] using a high-pressure hose. So there are all different ways in which these milk workers can easily become infected.”

Cook is also concerned about the possibility that the high pressure hoses that are used to spray down the parlors after milking may be aerosolizing virus that has fallen to the floor, making it easier for cows — and humans —to breathe in. He and other colleagues at the University of Wisconsin have begun deploying air monitoring devices into the milking parlors of affected farms to investigate the extent to which they can find genetic evidence of the virus in the air.


If so many dairy farm workers have been and are being exposed to H5N1, why has only one human infection been confirmed? Is that plausible?

Not likely.

Farmers, who mostly haven’t been willing to have their cows tested, haven’t been keen to have their workers tested either. The CDC’s Nirav Shah, principal deputy director, admitted as much last week. “These situations are challenging. There may be owners that are reluctant to work with public health to say nothing of individual workers who may be reluctant to sit down with somebody who identifies themself as being from the government in some way.” There have been reports that some farms may employ undocumented workers.

Dairy farm workers presenting with milder signs of illness, like conjunctivitis, also would make cases harder to spot. If only conjunctivitis is occurring, though, that presents another potential clue that people aren’t currently getting sick by breathing in H5N1, said Angela Rasmussen, a virologist who studies emerging zoonotic pathogens at the Vaccine and Infectious Disease Organization at the University of Saskatchewan in Canada. In the rare cases where people have contracted H5N1 from birds — mostly poultry farm workers and people with small backyard flocks — infections have resulted from close contact or exposure to aerosolized poultry waste. Since 2003, there have been 889 confirmed cases of human infection with H5N1; of those 52% were fatal.

“It’s entirely possible that there have been a lot of human cases from cows and people are just getting it in a different way,” Rasmussen said. “What that says about the risks to farm workers and dairy processing staff on a given farm or milking parlor is really unclear to me and it’s also something we need to urgently catch up on.”


Should more be done to find infected people?

The World Health Organization appears to be concerned about the possibility of undetected human cases. Maria Van Kerkhove, acting head of the department of epidemic and pandemic preparedness, told STAT she’d like to see, among other things, studies looking for antibodies to H5N1 in the blood of farm workers and people who’ve been in contact with farm workers, to determine if there have been unreported cases and possibly even spread from those individuals to others.

“For every human case of avian influenza since its emergence in 1996, 1997, there has always been … active case-finding, extensive testing, serologic surveys around humans. And we would certainly want to see that in any country, including in the U.S.,” said Van Kerkhove. “I’ve heard and read quite a bit about some potential additional cases. We’ve heard maybe conjunctivitis or whatnot. But I think what’s really critical now is to understand the extent of infection in humans.”

“The more we look, potentially the more we can find. And if we’re not looking, then we’re perhaps missing something that could be quite significant.”


Could people become infected by drinking milk containing H5N1 viruses?

Research is still being done to determine if all pasteurization techniques — there are multiple approaches — inactivate the virus. But the findings so far are reassuring. Scientists at St. Jude Children’s Hospital in Memphis, Tenn., have reported that while they could find genetic evidence of the virus in milk bought in stores, they could not grow live viruses from that milk, suggesting pasteurization kills H5N1.

But given the concentration of virus that researchers are seeing in milk from infected cows, they believe that raw milk — milk that has not been pasteurized — is an entirely different story.

Because so little testing has been reported, it’s really not known how many herds in how many parts of the country have been or are currently infected with H5N1. The USDA has reported 34 outbreaks in nine states since late March. It has not disclosed whether any of those dairy farms sold raw milk. Nor is it known if any raw milk producers have had bird flu infections in their cows.

If cows that produce milk destined for the raw milk market got infected with H5N1, people who consume that milk could drink a large dose of the virus, scientists say. Kuiken said he’s heard of concentrations that would be the equivalent of a billion virus particles per milliliter of milk. He told STAT he thought authorities should ban raw milk sales while the outbreak is underway.

 

[Heliobas Disciple]

https://www.thailandmedical.news/news/new-published-study-reveals-that-a-strain-of-h5n1-that-was-more-resistant-to-current-antivirals-was-killing-dolphins-in-florida-as-early-as-march-2022

(fair use applies)


New Published Study Reveals That A Strain Of H5N1 That Was More Resistant To Current Antivirals Was Killing Dolphins In Florida As Early As March 2022
Nikhil Prasad Fact checked by:Thailand Medical News Team
Apr 29, 2024

The discovery of highly pathogenic H5N1 avian influenza in a common bottlenose dolphin in Florida has raised significant concerns about the potential impact of avian influenza strains on marine mammal populations. This incident, documented in March 2022, marks the first known case of such a viral infection in a cetacean within North America, shedding light on the broader implications of avian influenza beyond traditional avian hosts. The report was only just published a week ago in the Nature journal Communications Biology.


Background and Context
Avian influenza viruses, particularly those of the H5N1 lineage, have garnered attention due to their impact on wild bird populations and domestic poultry. The emergence of highly pathogenic strains has led to widespread mortality among avian species, with occasional spillover events into mammalian populations as reported in the last 2 years in various studies, reports and H5N1 News coverages.

While terrestrial mammals like seals and foxes have previously been affected by H5N1, the case of a bottlenose dolphin presents a novel aspect of interspecies transmission.

Pathological and Virological Findings
The investigation into the infected dolphin revealed significant neurological inflammation and necrosis, indicating a viral infection affecting the central nervous system. Virus isolation and genome sequencing confirmed the presence of H5N1, specifically belonging to clade 2.3.4.4b.


Insights from Molecular Analysis: Understanding Viral Adaptation
Genomic sequencing of the A(H5N1) strain isolated from the dolphin revealed intriguing insights into its genetic makeup. While lacking clear adaptations for mammalian transmission, the virus exhibited reduced susceptibility to certain antiviral drugs, raising concerns about potential therapeutic challenges in future zoonotic events.

Sequence analysis was conducted to identify markers related to mammalian adaptation. The analysis revealed the presence of an HA-T192I (H3 numbering) amino acid substitution in the 190-helix near the receptor binding site, which has been linked to increased receptor a2,6-sialic acid binding. However, the specific impact of this substitution on sialic acid specificity in this A(H5N1) genetic context remains unknown. Additionally, the NA-S246N (N2 numbering) substitution, which is associated with reduced susceptibility to the neuraminidase inhibitor (NAI) oseltamivir, was found in the A/bottlenose dolphin/Florida/UFTt2203/2022 (H5N1) virus. No markers indicating resistance to adamantanes or endonuclease inhibitors were detected. Furthermore, the absence of PB2 substitutions commonly linked with mammalian infection in avian influenza viruses was noted.


Antiviral Susceptibility
The A/bottlenose dolphin/Florida/UFTt2203/2022 (H5N1) virus underwent evaluation for susceptibility to NAIs due to the NA-S246N substitution. Compared to the oseltamivir-susceptible reference virus A/Denmark/524/2009 (H1N1) pdm09, the A/bottlenose dolphin/Florida/UFTt2203/2022 (H5N1) virus exhibited an 18-fold decrease in oseltamivir susceptibility, with IC50 values of 7.51?nM vs. 0.41?nM, respectively.

For comparison, the reference virus A/Denmark/528/2009 (H1N1)pdm09 containing NA-H274Y (N2 numbering) was also assessed and exhibited significantly reduced inhibition by oseltamivir and peramivir, with IC50 values of 155.0?nM and 23.5?nM.

In summary, the presence of NA-S246N in A/bottlenose dolphin/Florida/UFTt2203/2022 (H5N1) resulted in decreased susceptibility to oseltamivir, aligning with the World Health Organization (WHO) guidance for NAI susceptibility reporting on the lower end of the inhibition scale.


Transmission Dynamics and Environmental Context
The precise route of transmission to the dolphin remains speculative, although environmental exposure to infected birds or direct interaction with avian carriers is considered plausible. The proximity of marine mammals to avian habitats, coupled with behaviors like predation or scavenging, increases the likelihood of viral transmission.


Implications for Marine Mammal Health and Conservation
The detection of avian influenza in a dolphin underscores the need for continued surveillance and monitoring of marine mammal populations. Understanding the potential for viral spillover and adaptation in non-traditional hosts is crucial for both wildlife health and human public health concerns.


Comparison with Previous Avian Influenza Cases in Marine Mammals
Historically, avian influenza infections in marine mammals have exhibited neurological signs and CNS involvement, similar to the findings in the infected dolphin. However, the susceptibility and transmission dynamics in cetaceans remain areas of ongoing research and investigation.


Public Health Considerations
While the current risk of H5N1 to human health is low, the potential for viral adaptation and enhanced replication in marine mammals raises concerns about future zoonotic risks. Vigilant surveillance, biosafety protocols, and antiviral research are essential components of mitigating these risks.


Conclusion
The case of H5N1 avian influenza in a bottlenose dolphin highlights the complex interplay between viral pathogens, wildlife populations, and environmental factors. Continued research and collaboration across disciplines are essential for addressing emerging infectious disease threats in marine ecosystems.


Recommendations for Future Research and Monitoring
-Comprehensive surveillance of avian influenza strains in marine mammal populations.

-Investigation into potential host adaptation and transmission dynamics of avian influenza in cetaceans.

-Development of antiviral strategies tailored to marine mammal species.

-Integration of wildlife health considerations into broader public health and conservation frameworks.


Final Thoughts
The case of H5N1 avian influenza in a bottlenose dolphin serves as a reminder of the interconnectedness of ecosystems and the need for proactive measures to safeguard wildlife and human populations against emerging infectious diseases. Through ongoing research, surveillance, and collaboration, we can better understand and mitigate the risks posed by zoonotic pathogens in marine environments.

What is concerning however is the fact that authorities and scientists in the United States are not publicly sharing critical data and study findings timely with the others. Many revelations are only coming to light months or years later.

The study findings are found here:

Highly pathogenic avian influenza A(H5N1) virus in a common bottlenose dolphin (Tursiops truncatus) in Florida - Communications Biology

A case report of highly pathogenic avian influenza A H5N1 of clade 2.3.4.4b in the brain of a common bottlenose dolphin (Tursiops truncatus) from Florida, United States.

www.nature.com

 

[Tristan]

Dr. Campbell discusses the issues with the Vakk's with Dr. Julian Gillespie (I believe...)


Indemnity Questioned

View: https://www.youtube.com/watch?v=LZrBRnKfuUs

RT: 17:01

Apparently a section of a longer video.

Dr. Campbell's guest discusses the mechanism how the vakk 'opens' the cells and 'allows' foreign DNA to be merged with the natural DNA. Mentions SV40 in particular...

This is happening in Australia (I believe...)

Also questions whether as a matter of law the vakks should have been labeled as a GMO, or GMO's.

This could explain quite a lot...

eta: this appears to be the full video:

View: https://www.youtube.com/watch?v=nbh_NB6LNaI

rt: 1:32:48

 

[jward]

Chuck Callesto
@ChuckCallesto

SHOCK REPORT: Breakthrough Therapy REVERSES Vaccine Harm..

FINALLY!!!

Dr. Doniparthi has successfully treated vaccine-injured patients using LRT in his own practice, including a 12-year-old boy who suffered stunted growth after three mRNA shots.

https://twitter.com/i/web/status/1785339039035400567

View: https://twitter.com/ChuckCallesto/status/1785339039035400567

 

[Heliobas Disciple]

Chinese scientist who published first sequence of COVID virus protests after being evicted from lab
April 29, 2024

SHANGHAI (AP) — The first scientist to publish a sequence of the COVID-19 virus in China was staging a sit-in protest after authorities locked him out of his lab.

Virologist Zhang Yongzhen wrote in an online post on Monday that he and his team were suddenly notified they were being evicted from their lab, the latest in a series of setbacks, demotions and ousters since he first published the sequence in early January 2020.

The move shows how the Chinese government continues to pressure and control scientists, seeking to avoid scrutiny of its handling of the coronavirus outbreak.

Zhang wrote the post on Chinese social media platform Weibo but it was later deleted.

In protest, Zhang had been sitting outside his lab since Sunday despite pouring rain, he said in the post. Zhang, when reached by phone on Tuesday, said it was “inconvenient” for him to speak, but a collaborator confirmed to AP on Monday the protest was taking place.

Chinese scientist who published COVID-19 virus sequence allowed back in his lab after sit-in protest

The first scientist to publish a sequence of the COVID-19 virus in China said he was allowed back into his lab after he spent days locked outside, sitting in protest. Zhang Yongzhen wrote in an online post on Wednesday, just past midnight, that the medical center that hosts his lab had...

news.yahoo.com

(fair use applies)


Chinese scientist who published COVID-19 virus sequence allowed back in his lab after sit-in protest
Associated Press
Updated Wed, May 1, 2024, 1:06 AM EDT

BEIJING (AP) — The first scientist to publish a sequence of the COVID-19 virus in China said he was allowed back into his lab after he spent days locked outside, sitting in protest.

Zhang Yongzhen wrote in an online post on Wednesday, just past midnight, that the medical center that hosts his lab had “tentatively agreed” to allow him and his team to return and continue their research for the time being.

“Now, team members can enter and leave the laboratory freely,” Zhang wrote in a post on Weibo, a Chinese social media platform. He added that he is negotiating a plan to relocate the lab in a way that doesn’t disrupt his team’s work with the Shanghai Public Health Clinical Center, which hosts Zhang’s lab.

Zhang had been staging a sit-in protest outside his lab since the weekend after he and his team were suddenly told they had to leave and were locked outside, a sign of continuing pressure on Chinese scientists conducting research on the coronavirus.

Zhang sat outside on flattened cardboard in drizzling rain, and members of his team unfurled a banner that read “Resume normal scientific research work," pictures posted online show. News of the protest spread widely on Chinese social media, putting pressure on local authorities.

In an online statement Monday, the Shanghai Public Health Clinical Center said that Zhang’s lab was being renovated and was closed for “safety reasons.” It added that it had provided Zhang’s team an alternative laboratory space.

But Zhang responded that his team wasn’t offered an alternative until after they were notified of their eviction, and the lab offered didn’t meet safety standards for conducting their research, leaving his team in limbo.

Zhang’s dispute with his host institution was the latest in a series of setbacks, demotions and ousters since the virologist published the sequence in January 2020 without state approval.

Beijing has sought to control information related to the virus since it first emerged. An Associated Press investigation found that the government froze domestic and international efforts to trace it from the first weeks of the outbreak. These days, labs are closed, collaborations shattered, foreign scientists forced out and some Chinese researchers barred from leaving the country.

Zhang’s ordeal started when he and his team decoded the virus on Jan. 5, 2020, and wrote an internal notice warning Chinese authorities of its potential to spread — but did not make the sequence public. The next day, Zhang’s lab was ordered to close temporarily by China’s top health official, and Zhang came under pressure by Chinese authorities.

Foreign scientists soon learned that Zhang and other Chinese scientists had deciphered the virus and called on China to release the sequence. Zhang published it on Jan. 11, 2020, despite a lack of permission from Chinese health officials.

Sequencing a virus is key to the development of test kits, disease control measures and vaccinations. The virus eventually spread to every corner of the world, triggering a pandemic that disrupted lives and commerce, prompted widespread lockdowns and killed millions of people.

Zhang was awarded prizes overseas in recognition for his work. But Chinese health officials removed Zhang from a post at the Chinese Center for Disease Control and Prevention and barred him from collaborating with some of his former partners, hindering his research.

Still, Zhang retains support from some in the government. Though some of Zhang’s online posts were deleted, his sit-in protest was reported widely in China’s state-controlled media, indicating divisions within the Chinese government on how to deal with Zhang and his team.

“Thank you to my online followers and people from all walks of life for your concern and strong support over the past few days!” Zhang wrote in his post Wednesday.

 

[Heliobas Disciple]

AstraZeneca Admits in Court Its COVID Vaccine Can Cause Deadly Side Effect

The pharmaceutical giant has admitted its vaccine can cause ‘vaccine-induced immune thrombotic thrombocytopenia’—dangerous blood clots—in some patients.

www.theepochtimes.com

(fair use applies)


AstraZeneca Admits in Court Its COVID Vaccine Can Cause Deadly Side Effect
The pharmaceutical giant has admitted its vaccine can cause ‘vaccine-induced immune thrombotic thrombocytopenia’—dangerous blood clots—in some patients.
By Rex Widerstrom
5/1/2024

Pharmaceutical manufacturer AstraZeneca has accepted for the first time that its COVID-19 vaccine can, “in very rare cases,” cause thrombosis with thrombocytopenia syndrome (TTS), which is characterised by blood clots (thrombosis) and low red blood cell counts (thrombocytopenia). It is also called vaccine-induced immune thrombotic thrombocytopenia (VITT).

This admission was made in a legal document submitted to the High Court in the UK, where the company is defending against a class action lawsuit alleging that its COVID-19 vaccine led to several deaths and serious injuries.

Last year, Jamie Scott, a father of two, filed a complaint against the British-Swedish multinational. He claimed that after receiving the vaccine in April 2021, he developed a blood clot resulting in severe brain impairment. At one point, the hospital informed his wife that he might not survive.
Mr. Scott alleges that the pharmaceutical giant overstated the vaccine’s effectiveness and downplayed its risks.


Blood Clot in the Brain

Ten days after his first dose, Mr. Scott woke up with a severe headache, started vomiting, and had trouble speaking. He was taken to hospital where he was diagnosed with a clot that was stopping blood from draining from his brain, as well as a haemorrhage in the brain itself. He had surgery and was in a coma for just over a month.

Mr. Scott has been left with poor memory, trouble reading, writing, listening, and speaking, is partially blind in both eyes, and suffers from pain and fatigue.

AstraZeneca now faces a class action with 51 patients and families alleging a link between the vaccine, known as Vaxzevria, and the rare condition and claiming damages of over £100 million (US$125 million), though Mr. Scott’s claim is expected to be heard first.

The claimants are pursuing a two-pronged strategy: taking legal action under the UK Consumer Protection Act 1987 as well as claiming payment under the government-run Vaccine Damage Payment Scheme.

The scheme has paid out in several cases but is limited to £120,000 per claim, and applicants must prove severe disablement.


AstraZeneca Denied Causal Link

Responding to Mr. Scott’s lawyers in May 2023, the company said, “We do not accept that TTS is caused by the vaccine at a generic level” but added, “Our sympathy goes out to anyone who has lost loved ones or reported health problems.”

“From the body of evidence in clinical trials and real-world data, Vaxzevria has continuously been shown to have an acceptable safety profile and regulators around the world consistently state that the benefits of vaccination outweigh the risks of extremely rare potential side effects,” the company said.

Even though the legal claim is against AstraZeneca, the UK taxpayer will have to pay any compensation awarded under an indemnity agreement that the government gave the company early in the pandemic.

One of two lawyers handling the claims, Peter Todd, a consultant solicitor with Scott-Moncrieff & Associates, said the complications associated with the vaccine included stroke, heart failure, and leg amputations. He said the technology involved in the AstraZeneca vaccine was “risky.”

According to Sarah Moore, a partner in the second legal firm, Hausfeld, damages awarded in the case could run into millions of pounds per claimant.

“We’ve been trying to get the government to reform their statutory scheme,” she said.
“We didn’t want to litigate but the government has forced us into a corner. The only way these families can get compensation is to fight the battle they didn’t want to fight.”


AstraZeneca Removes Vaccine from Australian Register

AstraZeneca manufactured the Oxford University vaccine on a not-for-profit basis and claimed it would deliver up to 3 billion doses of its vaccine across the globe by the end of 2021, just 18 months after development had begun.

An independent study by disease-forecasting company Airfinity, published in 2022, estimated the vaccine had saved more than six million lives in its first year of use, more than any other COVID-19 preventative.

In Australia, AstraZeneca Pty Ltd voluntarily removed Vaxzevria (previously known as COVID-19 Vaccine AstraZeneca) from the Australian Register of Therapeutic Goods in late April 2024.

According to the Therapeutic Goods Administration (TGA), Australia’s regulatory authority for therapeutic goods, this move was “a business decision of the company, due to no current or anticipated future demand of the vaccine, and follows similar business decisions made overseas.”


Reliant on Pharma Funding

In most countries, medicines regulators such as the TGA are primarily funded by the pharmaceutical industry, intended to support the cost of swiftly reviewing drug applications.

According to a recent comparison by the British Medical Journal, Australia’s regulator relies heavily on these fees, covering 96 percent of its operating costs, compared to 65 percent for the US Food and Drug Administration and 50.5 percent for Health Canada. The European Medicines Agency is closest to Australia’s figure, at 89 percent.

The closest to Australia’s figure is the European Medicines Agency, at 89 percent.

Members of the TGA approvals panel also had the second-highest declared conflicts of interest with the manufacturers of COVID-19 vaccines. Fifty percent declared such a conflict; 75 percent of Japan’s regulators had an issue. That compares to less than 10 percent in the U.S., three percent in Europe, and none in Canada.

Australia and Canada were the only jurisdictions in the sample that did not routinely publish members’ conflicts of interest as public information.

In 2020/21, the TGA approved more than nine of every 10 drug company applications, the second highest rate behind Europe.

 

[Heliobas Disciple]

Study identifies immunity threshold for protection against COVID-19 in children

As COVID-19 becomes endemic, an important group of people who continue to require vaccination is future birth cohorts of children. Yet, in the face of everchanging variants, as well as the waning of antibodies with time after each dose, key questions remain: What is the threshold of immune...

medicalxpress.com

(fair use applies)


Study identifies immunity threshold for protection against COVID-19 in children
by Duke-NUS Medical School
April 30, 2024

When SARS-CoV-2 breaks through the first layer of neutralizing and binding antibodies, T cells and memory B cells shield us from symptomatic and severe disease. Credit: NUS Yong Loo Lin School of Medicine


As COVID-19 becomes endemic, an important group of people who continue to require vaccination is future birth cohorts of children. Yet, in the face of everchanging variants, as well as the waning of antibodies with time after each dose, key questions remain: What is the threshold of immune response against SARS-CoV-2 needed to protect against COVID-19 and how many doses of mRNA vaccination are required to reach that threshold?

Researchers answered this question in a joint study conducted by the NUS Yong Loo Lin School of Medicine (NUS Medicine) and Duke-NUS Medical School. Titled "Correlates of protection against symptomatic SARS-CoV-2 in vaccinated children," the paper was published in Nature Medicine.

With parental consent and assent from child participants, the team enrolled 110 healthy children aged five to 12 years old into the MARkers of Vaccine Efficacy and Longevity in SARS-CoV-2 (MARVELS) study from 20 December 2021 to 8 March 2022, held at the National University Hospital (NUH). All participants received two doses of 10mcg Pfizer/BioNTech mRNA COVID-19 vaccination, 21 days apart.

The team followed up with the participants for one year, during which participants periodically donated blood to test for immune response to the vaccine: antibodies, memory B cells and T cells.

A proportion of the children received a booster dose five months after completing two doses, according to parental discretion. Parents also performed home antigen rapid tests (ARTs) for their children when COVID-19 was suspected, and reported to the study team when the results were confirmed. ART-confirmed symptomatic SARS-CoV-2 infection was the clinical outcome of interest in this study.

The team found that rather than antibodies, which wane with time and whose protective capacity decrease in the face of variants, other arms of the immune system—T cells and memory B cells—provide durable protection against symptomatic SARS-CoV-2 infection. The amount of T cells and memory B cells are generated after two doses of mRNA vaccination, and their levels were not improved with a third, 'booster' dose.

The researchers—Dr. Zhong Youjia, Assistant Professor Elizabeth Tham, and Professor Lynette Shek from the Department of Pediatrics at NUS Medicine, who are also consultants at the National University Hospital (NUH), and Professor Ooi Eng Eong from the Emerging Infectious Diseases Research Program at Duke-NUS Medical School—investigated the duration of effective immunity against COVID-19 after vaccination, and sought to find out which arms of the immune response conferred protection against disease.

Dr. Zhong, Senior Clinical Lecturer from the Department of Pediatrics at NUS Medicine and lead author of the study, said, "Just like how the air force, navy and army of a country's defense forces work together to provide a layered protection against enemy forces, these three arms of the immune system also confer protection in layers—when an enemy like SARS-CoV-2 breaks through the first layer of neutralizing antibodies due to viral mutations, T cells and memory B cells can equally protect against COVID-19. Importantly, T cells and memory B cells do not wane, and last for a long time."

A clinician scientist, Dr. Zhong is a Ph.D. candidate in the Emerging Infectious Diseases Research Program at Duke-NUS Medical School on the A*STAR MBBS-Ph.D. scholarship, and also a Visiting Consultant at the Khoo Teck Puat-National University Children's Medical Institute, NUH.
Main results

For protection against symptomatic SARS-CoV-2 infection, a very high amount of neutralizing antibodies is needed, which can be attained only with hybrid immunity (immunity from two doses of vaccine and one natural infection). In fact, a third dose of vaccination cannot help an individual attain such high levels of neutralizing antibodies.

Compared to acquisition of natural infection before completion of two doses, the quality of hybrid immunity was higher when natural infection was acquired after the completion of two doses of the vaccine.

Even without hybrid immunity, the memory B cells and T cell responses from mRNA vaccination alone effectively protect against symptomatic SARS-CoV-2 infection. This protection was seen even when the circulating omicron strain differed significantly from the ancestral strain which was used to design the vaccine. Memory B cells and T cells store immunological memory, and can respond quickly when the immune system is challenged, even when the attacking virus has mutated.

In the case where the amount of neutralizing antibodies was insufficient to prevent infection, the response provided by T cells was the single most important protective factor against symptomatic SARS-CoV-2 infection.

In their study, the scientists identified the minimum levels of antibodies, memory B cells and T cells needed to protect against symptomatic SARS-CoV-2 infection. The levels of memory B cells and T cells can be attained with two doses of mRNA vaccines whereas the levels of neutralizing antibodies needed to prevent infection can, in most children, only be attained with hybrid immunity.

The team thus created an "Onion model" to explain the layered protection provided by the immune system against the invading virus. This is a paradigm shift; rather than just using antibody levels to infer protection from COVID-19, T cell responses should be used instead.

Across the one-year follow up period of the study, memory B cells and T cell responses from two doses of vaccination remained stable with no signs of waning, and a third dose did not boost these responses. It may be deduced that: a) protection derived from two doses is lasting, and b) third and subsequent doses may not confer additional clinical protection.

In this study, healthy children, who received the third vaccine dose experienced more side effects, such as fever and pain, than with the first two doses.

Prof Ooi, the supervising scientist of the study, said, "This study provides evidence for clinical practice guidelines worldwide for the vaccination of future birth cohorts of children against COVID-19. The evidence supports a two-dose vaccination regimen for children."

Prof Ooi is also Associate Dean (Early Research Career Development) in the Office of Academic Medicine, Duke-NUS Medical School, and holds a joint Professorship at the Saw Swee Hock School of Public Health, National University of Singapore.

The study also found comparable immune responses in children compared to healthy adults. These findings do not apply, however, to children or adults who are more vulnerable to severe COVID-19, such as older adults and those living with chronic diseases or are immunocompromised. For them, third and subsequent doses of vaccination would still be beneficial.

It is important to note that the findings of this study need to be replicated by other researchers, and other evidence, including clinical experience with populations, need to be carefully considered in determining the optimum policy for vaccinations in children and adults.

The research team has further plans to study why some children develop better T cell responses than others, since T cell responses have been identified to be the most important predictor of protection. They hope to identify those children with poorer T cell responses, and tailor vaccination regimes to their immune systems and improve the future design of mRNA vaccines.

More information: Youjia Zhong et al, Correlates of protection against symptomatic SARS-CoV-2 in vaccinated children, Nature Medicine (2024). DOI: 10.1038/s41591-024-02962-3
Journal information: Nature Medicine
Provided by Duke-NUS Medical School

 

[Heliobas Disciple]

https://www.thailandmedical.news/news/brazilian-study-review-finds-that-probiotic-lactobacilli-has-therapeutic-potential-in-treating-covid-19

(fair use applies)


Brazilian Study Review Finds That Probiotic Lactobacilli Has Therapeutic Potential In Treating COVID-19
Nikhil Prasad Fact checked by:Thailand Medical News Team
May 01, 2024

The COVID-19 pandemic has swept across the globe, presenting unprecedented challenges to public health systems and medical communities worldwide. As researchers strive to uncover effective strategies to combat this viral infection, the potential role of probiotics has emerged as a subject of significant interest. Probiotics, known for their beneficial impact on gut health and immune modulation, are being investigated for their potential in managing COVID-19, particularly through the use of lactobacilli strains. This COVID-19 News report delves into the findings of a study review conducted by researchers from Universidade Federal do Rio Grande do Sul-Brazil and Universidade La Salle-Brazil studies that explored the therapeutic potential of probiotic lactobacilli in COVID-19 management, shedding light on their mechanisms of action and implications for future research and applications.

Thailand Medical News had previously covered numerous studies extolling the merits of various probiotics in helping with COVID-19 treatments.

https://www.thailandmedical.news/ne...-of-multistrain-probiotics-against-sars-cov-2

https://www.thailandmedical.news/ne...acillus-rhamnosus-can-help-against-sars-cov-2

https://www.thailandmedical.news/ne...ysbiosis-increases-risk-for-colorectal-cancer

https://www.thailandmedical.news/ne...-role-in-covid-19-progression-probiotics-help

https://www.thailandmedical.news/ne...oms-when-taken-as-a-post-exposure-prophylaxis

https://www.thailandmedical.news/ne...ecreases-risk-of-respiratory-failure-in-covid

https://www.thailandmedical.news/ne...could-be-used-as-adjuvants-to-treat-covid-19-

https://www.thailandmedical.news/ne...obiotics-for-treatments-and-as-prophylactics-

https://www.thailandmedical.news/ne...e-the-immune-system-to-fight-against-covid-19


Understanding Lactobacilli as Probiotics
Lactobacilli, a diverse group of Gram-positive, non-sporulating bacteria, are recognized for their probiotic properties. These bacteria are naturally present in the human gastrointestinal tract and play a crucial role in maintaining gut health and immune function. Recent advancements in molecular identification techniques have revealed the genetic diversity within the Lactobacillus genus, prompting a deeper understanding of their potential therapeutic applications.


Impact of Probiotic Lactobacilli on COVID-19
Several studies have investigated the use of probiotic lactobacilli in managing COVID-19 and its associated symptoms. For instance, a study by d’Etorre et al. (2020) evaluated the efficacy of a commercial probiotic containing lactobacilli strains in reducing diarrhea and improving respiratory outcomes in COVID-19 patients. The results showed a significant reduction in respiratory failure risk among patients receiving probiotic treatment, highlighting the potential of lactobacilli in mitigating severe COVID-19 complications.

Challenges in the Management of SARS-CoV2 Infection: The Role of Oral Bacteriotherapy as Complementary Therapeutic Strategy to Avoid the Progression of COVID-19 - PubMed

<span><b>Background:</b> Gastrointestinal disorders are frequent in COVID-19 and SARS-CoV-2 has been hypothesized to impact on host microbial flora and gut inflammation, infecting intestinal epithelial cells. Since there are currently no coded therapies or guidelines for treatment of COVID-19...

pubmed.ncbi.nlm.nih.gov

Similarly, Cecarelli et al. (2021) conducted a retrospective study demonstrating a reduced risk of mortality among COVID-19 patients treated with oral bacteriotherapy containing lactobacilli strains. These findings underscore the potential of probiotic lactobacilli in improving clinical outcomes and reducing mortality rates in COVID-19 cases.

Oral Bacteriotherapy in Patients With COVID-19: A Retrospective Cohort Study - PubMed

<span><b>Background:</b> Mounting evidence suggests SARS-CoV-2 may impact on host microbiota and gut inflammation, infecting intestinal epithelial cells. This possible link and its implications can be investigated by observing the effects of modulation of the microbial flora in patients with...

pubmed.ncbi.nlm.nih.gov

Immunomodulatory and Anti-inflammatory Mechanisms
The therapeutic effects of probiotic lactobacilli in COVID-19 management can be attributed to their immunomodulatory and anti-inflammatory properties. Lactobacilli strains have been shown to stimulate innate and adaptive immune responses, regulate cytokine production, and enhance mucosal immunity. By modulating immune responses and reducing inflammation, lactobacilli may help in mitigating the hyperactive immune response often observed in severe COVID-19 cases.

Studies have highlighted the interactions between lactobacilli strains and immune receptors such as Toll-like receptors (TLRs) and NOD-like receptors (NLRs), which play crucial roles in immune regulation. Through these interactions, lactobacilli can modulate cytokine production, inhibit pro-inflammatory pathways such as NF-?B activation, and promote anti-inflammatory cytokine synthesis. These mechanisms contribute to the overall immunomodulatory and anti-inflammatory effects of probiotic lactobacilli in COVID-19 management.


Direct Antiviral Effects
In addition to immunomodulation and anti-inflammatory actions, probiotic lactobacilli may exert direct antiviral effects against SARS-CoV-2, the virus responsible for COVID-19. Studies have suggested that lactobacilli strains can produce antimicrobial peptides, compete with pathogenic viruses for cellular binding sites, and interfere with viral replication processes. These direct antiviral mechanisms add to the therapeutic potential of lactobacilli in combating COVID-19 infections.


Challenges and Future Directions
While the findings from studies on probiotic lactobacilli in COVID-19 management are promising, several challenges and areas for future research must be addressed. Methodological differences among studies, including variations in probiotic strains, dosages, and study designs, contribute to mixed findings in clinical outcomes. Clear descriptions of randomization processes, larger sample sizes, and appropriate statistical analyses are crucial for minimizing bias and ensuring robust study outcomes.

Future research directions may include investigating specific lactobacilli strains' efficacy, exploring optimal dosages and treatment durations, and assessing long-term effects on gut microbiota and immune function. Collaborative efforts between researchers, healthcare professionals, and regulatory agencies are essential for translating research findings into clinical practice effectively.


Conclusion
In conclusion, probiotic lactobacilli show promise as adjunctive therapeutic agents in COVID-19 management. Their immunomodulatory, anti-inflammatory, and potential direct antiviral effects contribute to improved clinical outcomes and reduced mortality risk in COVID-19 patients. However, further research is warranted to optimize probiotic protocols, address methodological challenges, and enhance our understanding of lactobacilli's mechanisms of action in combating COVID-19. Probiotic lactobacilli represent a promising avenue for innovative approaches to COVID-19 treatment and warrant continued investigation and application in clinical settings.

The study findings were published in the peer reviewed journal: Nutrients.

The Influence of Probiotic Lactobacilli on COVID-19 and the Microbiota

This comprehensive review explores the potential of using lactobacilli as a probiotic in the management of COVID-19. Our findings suggest that lactobacilli show promise in reducing the risk of death, gastrointestinal and overall symptoms, and respiratory failure, as well as in lowering cytokines...

www.mdpi.com

Read Also:

https://www.thailandmedical.news/news/health-news-scientists-identify-two-probiotics-bifidobacterium-lactis-and-lactobacillus-rhamnosus-that-can-treat-hypertension

 

[Heliobas Disciple]

WHO picks JN.1 variant for next COVID shots (NYSE:PFE)

The World Health Organization has recommended updating COVID-19 vaccine formulations to reflect the dominant SARS-CoV-2 variant, JN.1. Read more here.

seekingalpha.com

(fair use applies)


WHO picks JN.1 variant for next set of COVID vaccines
Dulan Lokuwithana
Apr. 27, 2024 2:11 PM ET

Following a meeting of an advisory panel this week, the World Health Organization (WHO) recommended drugmakers to update their COVID-19 vaccine formulations to reflect the currently dominant SARS-CoV-2 variant, JN.1.

The decision came on Friday after the agency's technical experts on COVID-19 vaccines met early last week to determine the response of the latest crop of COVID shots to the fast-evolving SARS-CoV-2 virus.

According to data from the Centers for Disease Control and Prevention (CDC), Omicron JN.1 became the dominant COVID strain in the U.S. last December, days after the WHO classified it a "variant of interest" despite its low public health impact.

The currently approved COVID vaccines developed by Pfizer (NYSE:PFE), BioNTech (NASDAQ:BNTX), Moderna (NASDAQ:MRNA), and Novavax (NASDAQ:NVAX) are designed to target the XBB.1.5 Omicron subvariant.

The WHO said that the XBB.1.5-targeting vaccines would lose efficacy as the virus continues to evolve from JN.1.

"Given the displacement of XBB lineage variants by JN.1-derived variants, it is likely that, in the near term, circulating SARS-CoV-2 variants will be derived from JN.1," the agency noted.

While XBB.1.5-targeting vaccines offer limited protection against JN.1, "it is expected that the ability for XBB.1.5 vaccination to protect against symptomatic disease may be less robust as SARS-CoV-2 evolution continues from JN.1," the WHO said.

 

[Heliobas Disciple]

WHO picks JN.1 variant for next set of COVID vaccines (msn.com)

WHO picks JN.1 variant for next set of COVID vaccines (msn.com) Given the refocusing of the adaptive immune system to suboptimal humoral or cellular immune responses following re-exposure to the spike protein in previously COVID-19 (C-19) vaccine-primed individuals, the practice of updated...

voiceforscienceandsolidarity.substack.com

(fair use applies)

WHO picks JN.1 variant for next set of COVID vaccines
Geert Vanden Bossche
Apr 30, 2024

MSN

Given the refocusing of the adaptive immune system to suboptimal humoral or cellular immune responses following re-exposure to the spike protein in previously COVID-19 (C-19) vaccine-primed individuals, the practice of updated booster vaccines is counterproductive. It will no longer provide any protection against the currently circulating JN.1 quasispecies/clan and is even highly likely to promote immune pathology, including cancer, in C-19 vaccinees.

- But what's the point of having a candle and glasses if the owl doesn't want to
see? -